WormBase Tree Display for RNAi: WBRNAi00097918
expand all nodes | collapse all nodes | view schema
| WBRNAi00097918 | Homol | Homol_homol | F52B5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gttcgaattgttgcctatccacgacgtgactggaagaatttctgtgagcgagaagacgcaaaacaaaaggatttcagatttcccgagttacctgcctacaagaaggcgagcctagaatcgataaatatcaaacaagaggtcaatctagagaacatgttcaacgtgaccaatactactgcacaggtttgtctagaatatgatttaaaagaatttggaaaatagtaaataacttcaatttccaaaatcatgccttgtagaaatatcaattttctgccagaagaatataccatatttatcatgattcttttcaattttctatagaaaaacgttttcttcttgtttccgtcgaatgaacaaaaactgaattgaaattcgatatcttatctcccaatgacttcctttatgcgtaatgtttgctcgaccacaaagctttgaaatgttttatttcgatctaattttttaaatatatatgctctaattcccaagacattcaattattttctcaacgcaatatgaaataagattttaaatttacagatggaaccatcaacttcatattcatctccatcaaacagtaataatcggaagagatttttgaatgagtgtgattctccaaataatgattatacaatgatgcacagaactccaccagtaacaggttatgcaagtcgtcttcatggatgcgttcctccgattgaaactgaacacgaaaactgtcaatctccgtcgatgaagagaagtcgctgtaccaattattcgtttagaacgctcactgtaagtatttttagctcactcttaaagcaatattataattaattttgattcacaataaatttcagctgtcgactgctgagtatacaaaagtcgtcgaatttctggcacgcgaagcaaaagttcccagatacacttgggttccgacgcaagtagtctcccatatattgccaactgaaggacttgaaaggtatttataaagatttataaagattgccgtaatttcttttttttgaagattcctcaccgctataaaagcagggcacgattcagtgttgttcaatgcaaacggaatttatacaatgggggatatgattagagaattcgagaaacataatgacatcttcgaaagaattggtatcgattcttcgaaattgtcgaaatactacgaagcgtttctcagcttttaccgcatccaggaagcgatga | |||
| Experiment | Laboratory | TG | |||
| Date | 27 Sep 2001 00:00:00 | ||||
| Treatment | Approximately three P0 worms were added to the RNAi plate and incubated at 15 degrees Celsius for 72 hours. Three single F1 worms were each transferred into a new, freshly seeded plate and were allowed to lay eggs for approximately 20 hr. F1 worms were aspirated, and F2 worms were allowed to grow up to the L4 stage and analyzed for apoptosis. Germlines were scored for corpses 36 hours after the L4 larval stage. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F52B5.5a | Inferred_automatically | RNAi_primary | |
| F52B5.5b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00000467 | Inferred_automatically | RNAi_primary | ||
| Transcript | F52B5.5b.1 | Inferred_automatically | RNAi_primary | ||
| F52B5.5b.4 | Inferred_automatically | RNAi_primary | |||
| F52B5.5b.2 | Inferred_automatically | RNAi_primary | |||
| F52B5.5a.1 | Inferred_automatically | RNAi_primary | |||
| F52B5.5b.3 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004952 | ||||
| Phenotype_not_observed | WBPhenotype:0000590 | Remark | cep-1 RNAi did not affect the levels of normal, physiological germ cell death, compared to controls. | ||
| Remark | (Data not shown) cep-1 RNAi | ||||
| Method | RNAi |
