WormBase Tree Display for RNAi: WBRNAi00094831
expand all nodes | collapse all nodes | view schema
| WBRNAi00094831 | Homol | Homol_homol | F02E8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGATCCGTTTTATTCTGATCCAAAACCGTGCCGGTAAGACAAGATTGGCCAAATGGTATATGCACTTTGACGACGATGAGAAACAAAAACTGATCGAAGAAGTTCATGCGTGTGTGACCGTGCGAGATGCCAAGCACACGAATTTCGTCGAGTTCCGCAACTTCAAAATCGTATATCGTCGCTACGCCGGGCTGTACTTCTGCATTTGTGTTGACATCACCGACAATAACCTTTACTATCTGGAAGCTATTCACAATTTTGTCGAGGTTCTCAACGAGTACTTCCACAATGTGTGCGAGCTCGATTTGGTGTTCAACTTCTACAAAGTGTACACAGTCGTCGACGAGATGTTCCTTGCCGGCGAGATCCGTGAAACGTCACAAACAAAGGTGCTCAAACAGTTGCTCATGCTTACTTCCCTGGAATAG | |||
| Experiment | Laboratory | LJ | |||
| Date | 27 Jan 2000 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Temperature | 20 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F02E8.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000157 | Inferred_automatically | RNAi_primary | ||
| Transcript | F02E8.3.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004187 | ||||
| Phenotype | WBPhenotype:0000071 | Remark | Abnormal body shape, head and tail defects. | ||
| WBPhenotype:0000072 | Remark | Abnormal body shape, head and tail defects. | |||
| WBPhenotype:0000073 | Remark | Abnormal body shape, head and tail defects. | |||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
