WormBase Tree Display for RNAi: WBRNAi00094829
expand all nodes | collapse all nodes | view schema
| WBRNAi00094829 | Homol | Homol_homol | R07G3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGCAGACGATCAAGTGCGTCGTCGTTGGAGATGGAGCTGTCGGTAAAACTTGTCTCCTGATCAGCTATACCACAAACAAGTTTCCTTCTGAGTATGTGCCGACAGTCTTCGACAATTACGCCGTCACAGTAATGATCGGTGGCGAGCCATACACATTAGGATTGTTTGATACTGCTGGACAGGAAGATTACGATCGATTAAGGCCTCTATCGTATCCACAGACCGACGTGTTTCTTGTTTGCTTCTCCGTGGTTGCTCCAGCTTCATTCGAGAATGTCCGAGAAAAATGGGTGCCTGAAATTTCGCATCATTGCTCAAAGACCCCATTCTTGTTAGTTGGTACTCAAGTCGATCTCAGGGATGATCCAGGAATGCTCGAGAAACTGGCAAAAAACAAGCAGAAACCAGTGTCAACGGATGTTGGAGAGAAGTTGGCAAAGGAATTGAAAGCAGTGAAATACGTTGAATGCTCAGCGTTGACGCAGAAGGGACTGAAAAATGTATTCGACGAAGCCATTCTGGCCGCTCTCGACCCACCACAACAGGAGAAGAAGAAGAAGTGCAATATTCTCTAG | |||
| Experiment | Laboratory | MG | |||
| Date | 16 May 2000 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene | R07G3.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000390 | Inferred_automatically | RNAi_primary | ||
| Transcript | R07G3.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004196 | ||||
| Phenotype | WBPhenotype:0000365 | Remark | A minority (12 percent) of Cdc42(RNAi) embryos fail to initiate cytokinesis; in most cases, these embryos appear osmotically swollen even when provided with osmotic support. | ||
| Penetrance | Range | 12 | |||
| WBPhenotype:0001078 | Remark | A minority (12 percent) of Cdc42(RNAi) embryos fail to initiate cytokinesis; in most cases, these embryos appear osmotically swollen even when provided with osmotic support. | |||
| Penetrance | Range | 12 | |||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
