WormBase Tree Display for RNAi: WBRNAi00094569
expand all nodes | collapse all nodes | view schema
| WBRNAi00094569 | Homol | Homol_homol | C32D5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGAAGTGGGCTTACAAGGAGGAGAACAACTTTGAGAAGCGTCGTGCCGAAGGAGACAAGATCCGCAGAAAGTACCCAGACCGTATTCCAGTGATTGTTGAGAAAGCACCAAAGTCAAAGCTCCATGACTTGGATAAGAAGAAGTACTTGGTCCCATCCGATCTTACTGTTGGACAGTTCTACTTCCTCATCAGAAAACGCATCCAACTTCGTCCAGAAGATGCTCTGTTCTTCTTTGTCAACAATGTCATTCCACAAACCATGACCACAATGGGACAACTCTACCAGGACCATCACGAGGAAGACTTGTTCCTTTACATCGCCTACAGTGACGAAAGTGTGTATGGAGGAGAGGTCGAAAAGAAGGAATAA | |||
| Experiment | Laboratory | KLJ | |||
| Date | 07 Jul 2009 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Treatment | L4 hermaphrodites were put on RNAi and control plates for 36 h. The worms were then transferred to fresh RNAi and control plates, respectively. After 24 h, the parental worms were removed and the progeny were allowed to develop. The L4 hermaphrodites of RNAi-treated progeny were collected for experiments. These animals were on RNAi during development. | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C32D5.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002980 | Inferred_automatically | RNAi_primary | ||
| Transcript | C32D5.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00035076 | ||||
| Phenotype_not_observed | WBPhenotype:0001171 | Remark | lgg-1 RNAi in N2 (wild type) worms does not result in a decrease in lifespan | ||
| Remark | (Figure 1, Table S1) lgg-1 RNAi | ||||
| Method | RNAi |
