WormBase Tree Display for RNAi: WBRNAi00092504

WBRNAi00092504 Homol: Homol_homol: Y48C3A:RNAi
  Sequence_info: DNA_text: ATGCCTGGCGGAATGGGTTTTCCTAGTGATCCGGCACTTTTGCCACGTGTACAGGCTCACATTCGAAAGTTTCCCGGTACAAAATACTTTAAGCCGGAGCTTGTCGCCTACGATTTGCAGCAAGAGCATCCAGAATACCAACGAAAAAATCACAAAGTCTTTATGGGAATGGTGCGTGAAGCCTTGGAACGAATTCAGCTTGTCGCAAAAGAGGAAAATGACGAAAAAATGGAAGAAAAAGAGGCGATGGACGATGTACAGGAGATTCCAATTGTAAAAGCACTCGAGACACGGAAACGGAAGGCTCCGGCTGCTGGGAGGAAGAGCACAGGCCAAGCCGCCGCCGCCAAGGAAGTAGTGCTCAGCGACGATAGCGAGGACGAACGAGCCGCCCGTCAGCTCGAAAAACAAATTGAATCGCTCAAAACCAATCGGGCCAATAAGACCGTCCTCAATCTCTACACGAAAAAATCTGCTCCGAGCACTCCCGTTTCTACTCCGAAGAATCAAGCCACAAAGAAGCCTCCAGGAGCTTCTGCTGCTCCACCAGCTCTTCCACGTGGGCTCGGAGCCGTCAGCGACACGATCAGCCCGCGCGAGTCCCACGTGAAATTCGAGCACATTGGTGGAGCAGATCGCCAATTTCTTGAAGTTTGCCGGCTCGCAATGCACCTCAAACGTCCGAAAACCTTTGCCACACTGGGCGTCGACCCACCACGTGGATTTATTGTTCACGGACCGCCCGGATGTGGGAAGACAATGTTCGCGCAGGCGGTGGCCGGTGAGCTCGCGATTCCGATGCTCCAACTAGCGGCGACGGAGCTCGTGTCGGGAGTGTCTGGAGAGACGGAGGAGAAGATTCGCCGGCTTTTCGATACGGCCAAACAGAATAGTCCGTGTATTCTGATTCTTGATGATATTGATGCGATTGCACCGCGTCGGGAGACGGCGCAACGGGAAATGGAGCGGAGGGTTGTTAGTCAGTTGTGCAGTTCGTTGGATGAACTGGTACTTCCACCACGCGAAAAACCACTCAAAGATCAGCTAACATTCGGAGACGACGGCAGTGTAGCCATCATTGGAGACTCCCCGACTGCAGCTGGCGCCGGTGTTCTCGTAATTGGTACCACCTCCCGACCGGACGCCGTCGATGGAGGACTCCGACGAGCTGGACGCTTCGAAAATGAGATTTCGCTGGGAATCCCAGATGAGACAGCACGGGAGAAGATTCTGGAGAAAATATGTAAAGTGAACCTGGCCGGTGATGTGACACTGAAACAGATCGCCAAGCTCACGCCAGGCTACGTTGGAGCTGATCTTCAGGCACTGATCCGTGAAGCCGCCAAAGTTGCCATAGATCGAGTCTTCGATACGATCGTTGTCAAGAACGAGGGACACAAGAATCTGACCGTGGAGCAGATCAAGGAAGAGCTCGATCGGGTGCTCGCCTGGCTTCAAGGAGACGATGATCCATCGGCTCTATCGGAGCTCAACGGCGGGCTTCAAATCTCGTTTGAGGACTTTGAACGGGCTCTCTCGACGATTCAACCGGCGGCGAAGCGTGAAGGATTTGCGACGGTGCCTGATGTTTCTTGGGATGATATTGGAGCACTGGTGGAGGTGCGGAAGCAGTTGGAATGGAGCATTTTGTATCCGATTAAGAGAGCCGATGACTTTGCGGCTCTGGGAATTGACTGCAGGCCTCAGGGTATCCTGCTCTGCGGGCCGCCGGGCTGTGGAAAGACCCTACTAGCCAAGGCGGTGGCTAATGAGACGGGCATGAACTTTATCTCGGTGAAAGGCCCTGAATTATTGAATATGTATGTTGGAGAATCGGAAAGAGCCGTCAGAACGGTGTTCCAACGGGCTCGAGACTCCCAACCGTGTGTCATCTTCTTTGATGAGATTGATGCTCTTGTGCCGAAGAGATCGCATGGGGAGAGCTCTGGTGGAGCACGGCTTGTGAATCAGTTGCTCACTGAGATGGATGGTGTCGAGGGGAGACAGAAGGTTTTTCTGATTGGAGCCACTAATCGGCCGGACATTGTCGACGCGGCAATTCTCCGTCCAGGACGTCTCGACAAAATTCTATTCGTAGACTTCCCGTCAGTCGAGGATCGTGTCGATATTCTCCGAAAAAGCACGAAAAACGGAACTCGGCCGATGCTCGGCGAGGATATCGATTTTCACGAAATTGCTCAGCTTCCAGAACTTGCCGGTTTCACCGGCGCCGATCTGGCGGCTCTCATCCACGAATCGTCGCTTCTTGCACTACAAGCCAGAGTTTTAGAGAACGATGAATCCGTAAAAGGTGTCGGAATGCGTCATTTCCGTGAAGCTGCCTCCCGAATTCGCCCGTCTGTCACCGAGGCCGATCGGAAAAAGTATGAACATATGAAGAAGATCTACGGACTCAAACAAGCCACACCCCCATCCGTGTAG
  Experiment: Laboratory: RE
    Date: 09 Feb 1999 00:00:00
    Delivered_by: Injection
  Inhibits: Predicted_gene: Y48C3A.7 Inferred_automatically: RNAi_primary
    Gene: WBGene00003119 Inferred_automatically: RNAi_primary
    Transcript: Y48C3A.7.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00003523
  Phenotype: WBPhenotype:0000020 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0000059 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0000289 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0000691 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0000697 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0000699 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0000710 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
    WBPhenotype:0001428 Remark: mac-1(RNAi) animals complete embryogenesis and hatch, but most stop growing early in the second stage of larval development, and a few arrest later, in the L3 stage; all of these animals continue to move normally. Most of the mac-1(RNAi) animals remain arrested indefinitely, but some slowly continue development and eventually reach adulthood. In addition to this arrest, other defects were observed in mac-1(RNAi) animals. Even in the presence of food, the pharynges of young individuals did not pump normally. After several days, the intestines of most animals had large numbers of vacuoles, and some sections of the intestine were almost completely degraded. Finally, among the mac-1(RNAi) animals that eventually reached adulthood, defects in vulval and gonadal morphogenesis were observed. These defects included the formation of a protruding vulva, and aberrant uterine structure.
  Remark: mac-1 RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation.
  Method: RNAi