WormBase Tree Display for RNAi: WBRNAi00092472
expand all nodes | collapse all nodes | view schema
WBRNAi00092472 | Homol | Homol_homol | K07C11:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | ATGAGCGGAAAGGAAAATACTGCTCCTGTGATAGACGATCAGAAGGCCGAGGTTATTTCACTTACGGAAGATAGCAGACCTCAGAGAGTTGACCAGGCAAGGGAAGAATCATGCTGGAGTCTTGATGATTTTGACGTTGGACGGCCTCTCGGAAAAGGAAAGTTTGGAAACGTTTTCATCTCTCGTGAAAAAAAGACCAAGCGAATCATAGCTTTGAAAGTACTCTTCAAAACACAGTTGCTTCAACTTGGAGTCAGTCATCAGTTGAAGAGAGAGATCGAAATTCAATATCATTTGCGTCATCCGAATATTCTCACTCTTTATGGATACTTTCACGATGACAAGCGTGTGTTCGTCATTCTCGACTATGCCAGCAGAGGAGAATTATTTAATGTCCTCCAATCACAACCTGGACACAAAGTGAATGAGGTCATTGCCGGAAGATTTGTGCGACAGCTGGCCAATGCGTTGCATTACTGCCATTCGAAAGGAGTTATTCACAGAGACATTAAGCCTGAAAATCTTCTTCTTGATTCGAAGCTCAATCTGAAGCTTGCCGATTTCGGATGGTCCGTCGTTGCTGATCACTCGAAACGCCATACATTGTGCGGTACCATGGATTATCTTGCTCCGGAAATGGTTTCCAATCAGCCACATGACTTTAATGTTGACATTTGGGCAATTGGAATTCTTCTCTTCGAAATGCTTGTTGGATATGCTCCGTTCGCCAATCAAACTGGTGATAAATTGATCGCCAGAATCAAGGAGTGCAAGATTTATATTCCAAGTGTTGTGACTGACGGAGCTGCCAGTTTGATAAATGCAATAATCAAAAAGGAACCCCAAGAACGTCTCCCACTTGTTGACATCATGGCTCATCCGTGGATTAAGGAAATGAAGCAACGCGAAGACATTGAAGTTCCACTCTTCATTTCGACGCTCACGAAATCCAGTCGCAATAATTCTACAGCCAATCAATAA | ||||
Experiment | Laboratory | AG | ||||
Date | 24 Aug 1998 00:00:00 | |||||
Treatment | L4 and adult N2 hermaphrodites were injected with antisense RNA by standard methods and were allowed to recover for 12-24 hours before fixation for immunocytochemistry. | |||||
Delivered_by | Injection | |||||
Inhibits (3) | ||||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00003325 | |||||
Phenotype | WBPhenotype:0000628 | Remark | 22% of AB cells and 22% of P1 cells in the air-1 RNAi 2-cell embryo exhibited small spindles. Spindles were designated as "small" if they had smaller centrosomes and/or shorter microtubules (microtubules do not reach the cell cortex) as compared to wild-type spindles at similar stages of the cell cycle | |||
EQ_annotations | Life_stage | WBls:0000007 | PATO:0000460 | |||
WBPhenotype:0000759 | Remark | 28% of AB cells and 31% of P1 cells in the air-1 RNAi 2-cell embryo exhibited an inappropriate interphase-like array of spindles during mitosis. An interphase-like array was judged as inappropriate if it was found in a cell with condensed chromatin | ||||
EQ_annotations | Life_stage | WBls:0000007 | PATO:0000460 | |||
WBPhenotype:0000765 | Remark | 3% of AB cells and 6% of P1 cells in the air-1 RNAi 2-cell embryo exhibited a stretched midbody. Anaphase spindles that were longer than wild type appeared to have "stretched midbodies" as compared to wild-type controls | ||||
EQ_annotations | Life_stage | WBls:0000007 | PATO:0000460 | |||
WBPhenotype:0001106 | Remark | 6% of air-1 RNAi 2-cell embryos exhibited both spindles in the same orientation | ||||
EQ_annotations | Life_stage | WBls:0000007 | PATO:0000460 | |||
WBPhenotype:0001588 | Remark | 22% of AB cells and 22% of P1 cells in the air-1 RNAi 2-cell embryo exhibited spindles with fewer microtubules. Spindles were designated as having fewer microtubules if the microtubule density (as assessed by eye) was much less than a wild-type spindle | ||||
EQ_annotations | Life_stage | WBls:0000007 | PATO:0000460 | |||
WBPhenotype:0001903 | Remark | 3% of AB cells in the air-1 RNAi 2-cell embryo exhibited multiple centrosomes (more than two per cell). | ||||
EQ_annotations | Life_stage | WBls:0000007 | PATO:0000460 | |||
Remark | (Table 2) air-1 RNAi | |||||
Method | RNAi |