WormBase Tree Display for RNAi: WBRNAi00092471

WBRNAi00092471 Homol: Homol_homol: K07C11:RNAi
  Sequence_info: DNA_text: ATGAGCGGAAAGGAAAATACTGCTCCTGTGATAGACGATCAGAAGGCCGAGGTTATTTCACTTACGGAAGATAGCAGACCTCAGAGAGTTGACCAGGCAAGGGAAGAATCATGCTGGAGTCTTGATGATTTTGACGTTGGACGGCCTCTCGGAAAAGGAAAGTTTGGAAACGTTTTCATCTCTCGTGAAAAAAAGACCAAGCGAATCATAGCTTTGAAAGTACTCTTCAAAACACAGTTGCTTCAACTTGGAGTCAGTCATCAGTTGAAGAGAGAGATCGAAATTCAATATCATTTGCGTCATCCGAATATTCTCACTCTTTATGGATACTTTCACGATGACAAGCGTGTGTTCGTCATTCTCGACTATGCCAGCAGAGGAGAATTATTTAATGTCCTCCAATCACAACCTGGACACAAAGTGAATGAGGTCATTGCCGGAAGATTTGTGCGACAGCTGGCCAATGCGTTGCATTACTGCCATTCGAAAGGAGTTATTCACAGAGACATTAAGCCTGAAAATCTTCTTCTTGATTCGAAGCTCAATCTGAAGCTTGCCGATTTCGGATGGTCCGTCGTTGCTGATCACTCGAAACGCCATACATTGTGCGGTACCATGGATTATCTTGCTCCGGAAATGGTTTCCAATCAGCCACATGACTTTAATGTTGACATTTGGGCAATTGGAATTCTTCTCTTCGAAATGCTTGTTGGATATGCTCCGTTCGCCAATCAAACTGGTGATAAATTGATCGCCAGAATCAAGGAGTGCAAGATTTATATTCCAAGTGTTGTGACTGACGGAGCTGCCAGTTTGATAAATGCAATAATCAAAAAGGAACCCCAAGAACGTCTCCCACTTGTTGACATCATGGCTCATCCGTGGATTAAGGAAATGAAGCAACGCGAAGACATTGAAGTTCCACTCTTCATTTCGACGCTCACGAAATCCAGTCGCAATAATTCTACAGCCAATCAATAA
  Experiment: Laboratory: AG
    Date: 24 Aug 1998 00:00:00
    Treatment: L4 and adult N2 hermaphrodites were injected with antisense RNA by standard methods and were allowed to recover for 12-24 hours before fixation for immunocytochemistry.
    Delivered_by: Injection
  Inhibits: Predicted_gene: K07C11.2 Inferred_automatically: RNAi_primary
    Gene: WBGene00000098 Inferred_automatically: RNAi_primary
    Transcript: K07C11.2.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00003325
  Phenotype: WBPhenotype:0000628 Remark: 44% of air-1 RNAi embryos at the one-cell stage exhibited small spindles. Spindles were designated as "small" if they had smaller centrosomes and/or shorter microtubules (microtubules do not reach the cell cortex) as compared to wild-type spindles at similar stages of the cell cycle
      Penetrance: Range: 44
      EQ_annotations: Life_stage: WBls:0000006 PATO:0000460
    WBPhenotype:0000759 Remark: 44% of air-1 RNAi embryos at the one-cell stage exhibited an inappropriate interphase-like array of spindles during mitosis. An interphase-like array was judged as inappropriate if it was found in a cell with condensed chromatin
      Penetrance: Range: 44
      EQ_annotations: Life_stage: WBls:0000006 PATO:0000460
    WBPhenotype:0000765 Remark: 25% of air-1 RNAi embryos at the one-cell stage exhibited a stretched midbody. Anaphase spindles that were longer than wild type appeared to have "stretched midbodies" as compared to wild-type controls
      Penetrance: Range: 25
      EQ_annotations: Life_stage: WBls:0000006 PATO:0000460
    WBPhenotype:0001588 Remark: 44% of air-1 RNAi embryos at the one-cell stage exhibited spindles with fewer microtubules. Spindles were designated as having fewer microtubules if the microtubule density (as assessed by eye) was much less than a wild-type spindle
      Penetrance: Range: 44
      EQ_annotations: Life_stage: WBls:0000006 PATO:0000460
    WBPhenotype:0001903 Remark: 13% of air-1 RNAi embryos at the one-cell stage exhibited multiple centrosomes (more than two per cell).
      Penetrance: Range: 13
      EQ_annotations: Life_stage: WBls:0000006 PATO:0000460
  Remark: (Table 2) air-1 RNAi
  Method: RNAi