WormBase Tree Display for RNAi: WBRNAi00092469

WBRNAi00092469 Homol: Homol_homol: K07C11:RNAi
  Sequence_info: DNA_text: ATGAGCGGAAAGGAAAATACTGCTCCTGTGATAGACGATCAGAAGGCCGAGGTTATTTCACTTACGGAAGATAGCAGACCTCAGAGAGTTGACCAGGCAAGGGAAGAATCATGCTGGAGTCTTGATGATTTTGACGTTGGACGGCCTCTCGGAAAAGGAAAGTTTGGAAACGTTTTCATCTCTCGTGAAAAAAAGACCAAGCGAATCATAGCTTTGAAAGTACTCTTCAAAACACAGTTGCTTCAACTTGGAGTCAGTCATCAGTTGAAGAGAGAGATCGAAATTCAATATCATTTGCGTCATCCGAATATTCTCACTCTTTATGGATACTTTCACGATGACAAGCGTGTGTTCGTCATTCTCGACTATGCCAGCAGAGGAGAATTATTTAATGTCCTCCAATCACAACCTGGACACAAAGTGAATGAGGTCATTGCCGGAAGATTTGTGCGACAGCTGGCCAATGCGTTGCATTACTGCCATTCGAAAGGAGTTATTCACAGAGACATTAAGCCTGAAAATCTTCTTCTTGATTCGAAGCTCAATCTGAAGCTTGCCGATTTCGGATGGTCCGTCGTTGCTGATCACTCGAAACGCCATACATTGTGCGGTACCATGGATTATCTTGCTCCGGAAATGGTTTCCAATCAGCCACATGACTTTAATGTTGACATTTGGGCAATTGGAATTCTTCTCTTCGAAATGCTTGTTGGATATGCTCCGTTCGCCAATCAAACTGGTGATAAATTGATCGCCAGAATCAAGGAGTGCAAGATTTATATTCCAAGTGTTGTGACTGACGGAGCTGCCAGTTTGATAAATGCAATAATCAAAAAGGAACCCCAAGAACGTCTCCCACTTGTTGACATCATGGCTCATCCGTGGATTAAGGAAATGAAGCAACGCGAAGACATTGAAGTTCCACTCTTCATTTCGACGCTCACGAAATCCAGTCGCAATAATTCTACAGCCAATCAATAA
  Experiment: Laboratory: AG
    Date: 24 Aug 1998 00:00:00
    Treatment: L4 and adult N2 hermaphrodites were injected with antisense RNA by standard methods and were allowed to recover for 12-24 hours before fixation for immunocytochemistry.
    Delivered_by: Injection
  Inhibits: Predicted_gene: K07C11.2 Inferred_automatically: RNAi_primary
    Gene: WBGene00000098 Inferred_automatically: RNAi_primary
    Transcript: K07C11.2.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00003325
  Phenotype: WBPhenotype:0000773 Remark: 29% of AB cells and 23% of P1 cells in the air-1 RNAi 2-cell embryo exhibited free chromosomes. A cell was designated as having a free chromosome or chromosomes if at least one chromosome was found to be well separated from the main chromatinmass of the cell.
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001027 Remark: 9% of AB cells and 2% of P1 cells in the air-1 RNAi 2-cell embryo exhibited misplaced nuclei
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001123 Remark: 4% of air-1 RNAi 2-cell embryos exhibited synchronous cell-cycle timing in both cells.
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001142 Remark: 13% of AB cells and 20% of P1 cells in the air-1 RNAi 2-cell embryo exhibited two or more nuclei per cell
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001174 Remark: 0% of AB cells and 9% of P1 cells in the air-1 RNAi 2-cell embryo exhibited all chromosomes in a single cell
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001348 Remark: 14% of AB cells and 9% of P1 cells in the air-1 RNAi 2-cell embryo exhibited hyper-condensed chromatin
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001362 Remark: 9% of AB cells and 14% of P1 cells in the air-1 RNAi 2-cell embryo exhibited string-like (unraveling, fragmented or decondensed) chromatin
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001584 Remark: 14% of AB cells and 13% of P1 cells in the air-1 RNAi 2-cell embryo exhibited wrong orientation. Wrong orientation refers to metaphase or anaphase cells that had chromosomes that were aligned in an abnormal orientation as compared to wild-type cells.For instance, some abnormal 1-cell mitotic embryos had anaphase figures that were perpendicular to the long axis of the embryo rather than parallel to the longaxis as in wild-type cells of the same stage.
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001875 Remark: 21% of AB cells and 20% of P1 cells in the air-1 RNAi 2-cell embryo exhibited chromatin bridges
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
    WBPhenotype:0001882 Remark: 34% of AB cells and 39% of P1 cells in the air-1 RNAi 2-cell embryo exhibited polyploidy
      EQ_annotations: Life_stage: WBls:0000007 PATO:0000460
  Remark: (Table 1) air-1 RNAi
  Method: RNAi