WormBase Tree Display for RNAi: WBRNAi00092468
expand all nodes | collapse all nodes | view schema
WBRNAi00092468 | Homol | Homol_homol | K07C11:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | ATGAGCGGAAAGGAAAATACTGCTCCTGTGATAGACGATCAGAAGGCCGAGGTTATTTCACTTACGGAAGATAGCAGACCTCAGAGAGTTGACCAGGCAAGGGAAGAATCATGCTGGAGTCTTGATGATTTTGACGTTGGACGGCCTCTCGGAAAAGGAAAGTTTGGAAACGTTTTCATCTCTCGTGAAAAAAAGACCAAGCGAATCATAGCTTTGAAAGTACTCTTCAAAACACAGTTGCTTCAACTTGGAGTCAGTCATCAGTTGAAGAGAGAGATCGAAATTCAATATCATTTGCGTCATCCGAATATTCTCACTCTTTATGGATACTTTCACGATGACAAGCGTGTGTTCGTCATTCTCGACTATGCCAGCAGAGGAGAATTATTTAATGTCCTCCAATCACAACCTGGACACAAAGTGAATGAGGTCATTGCCGGAAGATTTGTGCGACAGCTGGCCAATGCGTTGCATTACTGCCATTCGAAAGGAGTTATTCACAGAGACATTAAGCCTGAAAATCTTCTTCTTGATTCGAAGCTCAATCTGAAGCTTGCCGATTTCGGATGGTCCGTCGTTGCTGATCACTCGAAACGCCATACATTGTGCGGTACCATGGATTATCTTGCTCCGGAAATGGTTTCCAATCAGCCACATGACTTTAATGTTGACATTTGGGCAATTGGAATTCTTCTCTTCGAAATGCTTGTTGGATATGCTCCGTTCGCCAATCAAACTGGTGATAAATTGATCGCCAGAATCAAGGAGTGCAAGATTTATATTCCAAGTGTTGTGACTGACGGAGCTGCCAGTTTGATAAATGCAATAATCAAAAAGGAACCCCAAGAACGTCTCCCACTTGTTGACATCATGGCTCATCCGTGGATTAAGGAAATGAAGCAACGCGAAGACATTGAAGTTCCACTCTTCATTTCGACGCTCACGAAATCCAGTCGCAATAATTCTACAGCCAATCAATAA | ||||
Experiment | Laboratory | AG | ||||
Date | 24 Aug 1998 00:00:00 | |||||
Treatment | L4 and adult N2 hermaphrodites were injected with antisense RNA by standard methods and were allowed to recover for 12-24 hours before fixation for immunocytochemistry. | |||||
Delivered_by | Injection | |||||
Inhibits (3) | ||||||
Species | Caenorhabditis elegans | |||||
Reference | WBPaper00003325 | |||||
Phenotype | WBPhenotype:0000773 | Remark | 20% of air-1 RNAi embryos at the one-cell stage exhibited free chromosomes. A cell was designated as having a free chromosome or chromosomes if at least one chromosome was found to be well separated from the main chromatinmass of the cell. | |||
Penetrance | Range | 20 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001027 | Remark | 8% of air-1 RNAi embryos at the one-cell stage exhibited misplaced nuclei | ||||
Penetrance | Range | 8 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001348 | Remark | 5% of air-1 RNAi embryos at the one-cell stage exhibited hyper-condensed chromatin | ||||
Penetrance | Range | 5 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001362 | Remark | 34% of air-1 RNAi embryos at the one-cell stage exhibited string-like (unraveling, fragmented or decondensed) chromatin | ||||
Penetrance | Range | 34 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001584 | Remark | 14% of air-1 RNAi embryos at the one-cell stage exhibited wrong orientation. Wrong orientation refers to metaphase or anaphase cells that had chromosomes that were aligned in an abnormal orientation as compared to wild-type cells.For instance, some abnormal 1-cell mitotic embryos had anaphase figures that were perpendicular to the long axis of the embryo rather than parallel to the longaxis as in wild-type cells of the same stage. | ||||
Penetrance | Range | 14 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001875 | Remark | 31% of air-1 RNAi embryos at the one-cell stage exhibited chromatin bridges | ||||
Penetrance | Range | 31 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001882 | Remark | 17% of air-1 RNAi embryos at the one-cell stage exhibited polyploidy | ||||
Penetrance | Range | 17 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
WBPhenotype:0001895 | Remark | 19% of air-1 RNAi embryos at the one-cell stage exhibited failed pronuclear fusion | ||||
Penetrance | Range | 19 | ||||
EQ_annotations | Life_stage | WBls:0000006 | PATO:0000460 | |||
Remark | (Table 1) air-1 RNAi | |||||
Method | RNAi |