WormBase Tree Display for RNAi: WBRNAi00092446

WBRNAi00092446 Homol: Homol_homol: F54C9:RNAi
  Sequence_info: DNA_text: ATGAGTGACAGTACTGGAAGAATCAACTCGAAAGCTTCGGATTCATCGTCGATCAGCGATCACCAAACTGCCGATCTCAGCATTTTCAACGGATCCTTCGATGGAGGTGCATTCTCATCGTCCAACATTCCTCTGTTCAACTTCATGGGAACTGGGAACCAGCGCTTCCAATACTCGCCACATCCATTTGCCAAGTCGAGTGATCCGTGTCGTCTGGCTGCCTTGACACCGTCTACACCGAAAGGCCCATTGAACTTGACTCCTGCTGACTTTGGGCTTGCCGATTTTTCCGTTGGAAACGAGTCGTTTGCCGATTTCACCGCCAACAATACGTCATTCGTTGGAAACGTCCAGAGCAATGTTCGATCAACCCGTCTTTTGCCTGCCTGGGCTGTCGACAACAGCGGAAACATTCGGGATGACCTCACTCTCCAAGATGTTGTTAGCAACGGATCGCTTATCGATTTCGCTATGGATAGAACTGGAGTCAAGTTCCTGGAGCGCCATTTCCCAGAAGATCATGATAACGAGATGCACTTTGTGCTCTTTGACAAACTTACTGAGCAGGGTGCTGTCTTCACCAGTCTTTGCCGCAGTGCTGCCGGAAATTTCATCATCCAGAAGTTTGTTGAACATGCAACCCTTGACGAACAGGAACGCCTCGTCCGCAAGATGTGTGACAACGGATTGATCGAAATGTGCCTCGACAAGTTTGCTTGCCGTGTGGTGCAGATGTCGATCCAGAAATTCGATGTCTCGATCGCGATGAAGCTCGTCGAAAAGATCAGCAGTCTTGATTTTCTGCCACTTTGCACCGATCAATGCGCCATCCACGTTCTGCAGAAAGTTGTCAAACTGTTACCAATTAGTGCGTGGAGTTTCTTCGTCAAATTTCTGTGTCGCGATGACAACCTGATGACTGTTTGCCAAGACAAGTATGGTTGCCGTCTCGTTCAGCAAACCATCGACAAGCTGTCTGATAATCCGAAGCTCCATTGCTTCAACACACGTCTTCAGCTCCTGCATGGACTCATGACATCAGTGGCACGCAACTGCTTCCGACTTTCATCGAACGAGTTCGCTAACTACGTCGTTCAATACGTCATCAAGTCCTCTGGAGTCATGGAAATGTACCGTGATACAATCATCGAAAAATGTCTTCTCCGTAACATTCTATCGATGTCGCAAGACAAGTATGCTTCCCATGTTGTGGAAGGAGCTTTTCTCTTTGCTCCACCTCTCTTGCTCTCAGAGATGATGGACGAAATCTTCGATGGATATGTGAAGGATCAGGAGACGAACCGTGATGCTCTGGACATCTTGTTGTTCCATCAATACGGGAACTATGTCGTCCAACAGATGATTTCCATCTGCATTTCTGCACTTCTCGGAAAAGAGGAACGTAAGATGGTGGCATCGGAAATGCGCCTCTATGCCAAATGGTTCGATCGGATCAAGAATCGTGTCAACCGTCATTCCGGCCGCCTTGAGCGTTTTTCCTCTGGAAAGAAAATAATCGAGTCGCTCCAGAAGCTCAATGTGCCAATGACGATGACGAATGAGCCAATGCCATACTGGGCTATGCCAACTCCACTCATGGACATCAGTGCCCATTTCATGAACAAACTGAACTTCCAGAAGAATTCCGTCTTCGACGAA
  Experiment: Laboratory: MW
    Date: 17 Oct 1997 00:00:00
    Treatment: Injections used uncapped antisense RNA at a concentration of 5.0 mg/ml RNA. Germ lines of progeny produced between 12 and 48 hours after injection were examined for gamete differentiation either by Nomarski microscopy or fertility.
    Delivered_by: Injection
  Inhibits: Predicted_gene: F54C9.8 Inferred_automatically: RNAi_primary
    Gene: WBGene00004241 Inferred_automatically: RNAi_primary
    Transcript: F54C9.8.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00002949
  Phenotype_not_observed: WBPhenotype:0000050 Remark: F54C9.8 RNAi resulted in the normal numbers of sperm and oocytes. Also the following were NOT observed following RNAi: sexual transformation of somatic cells, embryonic lethality, uncoordinated behavior, or morphological defects.
    WBPhenotype:0000291 Remark: F54C9.8 RNAi resulted in the normal numbers of sperm and oocytes. Also the following were NOT observed following RNAi: sexual transformation of somatic cells, embryonic lethality, uncoordinated behavior, or morphological defects.
    WBPhenotype:0000385 Remark: F54C9.8 RNAi resulted in the normal numbers of sperm and oocytes. Also the following were NOT observed following RNAi: sexual transformation of somatic cells, embryonic lethality, uncoordinated behavior, or morphological defects.
    WBPhenotype:0000414 Remark: F54C9.8 RNAi resulted in the normal numbers of sperm and oocytes. Also the following were NOT observed following RNAi: sexual transformation of somatic cells, embryonic lethality, uncoordinated behavior, or morphological defects.
    WBPhenotype:0000520 Remark: F54C9.8 RNAi resulted in the normal numbers of sperm and oocytes. Also the following were NOT observed following RNAi: sexual transformation of somatic cells, embryonic lethality, uncoordinated behavior, or morphological defects.
    WBPhenotype:0000643 Remark: F54C9.8 RNAi resulted in the normal numbers of sperm and oocytes. Also the following were NOT observed following RNAi: sexual transformation of somatic cells, embryonic lethality, uncoordinated behavior, or morphological defects.
  Remark: (Figure 4) F54C9.8 RNAi
  Method: RNAi