WormBase Tree Display for RNAi: WBRNAi00088413

WBRNAi00088413 Homol: Homol_homol: F18E2:RNAi
  Sequence_info: DNA_text: ATGTCGGAGACACCTACAGATCAGTCCCCTCAGCGGATGTCCACGAGAAACCAAGCCCGTGTCAACTACACGGATATGGCAGCTGGAAACAATTCAGTAGAAAAGGAGCCTGTATTTCGTTCACCAACAGCTAGCACTCGAGGACGAAAAAAACGAGCCGCTAATGTCGATGTTGCGGATCTTTCGGCCAGCTTTGGCAATCTGAATAACTTCAGCACGCCTCCGAAACGCGGCCGTCCACGAGGTGGGGGTTTAGGAAGTGCGCGTGGAGGAAGAGCACCAATGGTTCGACGAACGACAACAGAGGAATCTGCTGAAGTAGATGATCGCGAGCTTGTAGCTGCCGTTAAATCAGGAAAGAAAATCACGGAAGCGGTAGACAGATGGATTGGCCGTTACAACGAAAAATTTCTGGTTGCAATTGCCGAGATGCATCAATTTTTCTTCGCAATCTGTGGATGCAAAGGAATTGTCACACCACAAATGTCAGCAACTCTTACCTACAAAGACATCATTTGTCGGATGACAGAAGATTTTGAAGAGGATTCCGCTGACTATCCATTAGTTCATGGAGGAAGTCTGAAAAAAGTTCGCGCAAATCTTCACAATTTCATTCATACTCTGATCATCAGAACCAAAGCGTCAATGCTTTTCGATAGCAATCTTATGGATGGTTTTGTGCAGTTGCTGACTGGAATGGCTGACAGTCAAGTTCGTGCATTCCGGCACACAGCGACTTTTTGCGCTATGAAGATCACATCAGCGCTTGTTGACGTCACCATTGAACTTACACAGTCGAAAGAAAAAACTTCAAAGCAAATTGAAGCAGAGAAGGCCAAGCTGAAGAACAATTCGGCTGGAAATGAAAAATACGAGGCACTTGTTGCACAAAGGACTCAAACAGAAGAACGCGCTGAAGAGATTCGTCAAATCATCGGATACTTATTCAGAAGTGTCTTTGTTCATCGCTATCGTGATGTGGTACCAGACATTCGATGTATATGTATTCAAGAACTCGGTCACTGGATGGATGTTTATCCAGAGCATTTTGTTGAGGATTCATATCTCAAGTATATTGGCTGGTCAATGTTTGATAAAGTTGGTGACGTGAGACAAAGATGTATTCGCGCTTTGATTCCACTTTTCGAGAAGACGTTGATTCTGGATAAACTAGAATTGTTCGTCAATAAATTCAAAGATCGCCTCGTTTCAATGCTACTTGATAAGGATTTAGAGACAAGTATTGAAACTGTTCACTTGATGCGTGTTCTCTATACAGTTTTCCCTACTCTTCTTACAATCAAAGACGTCGTTCCGATCTACGAGCTGATCTATGCTTCAAATCGTCCATTAGCTGTTGCCGCTGGAATGTTCTTGAATACAAAAGTTTTTCGAAGTGCAGAGAAACCAGGAAAAGCGCCAACTGCTGCAAACATTCCTTTGGTGAAAGATCTCACGACGTTCTTCATCGAAGGAGATCTTCATCAACATGCAACGTATTTGGTTGACGCACTTTTTGAAAGCAATCCAATTGTGAAGGATTGGGCGACAATGGGAGAATTATTGATTAACGATCAGTATCAATTGGACTCCAACTTCGAGACAAAATTAATCGAGATCCTTACTTGCTCTGTAGTGCAATCTGCAACTGGAGAGCCCCCTGTAGGAAGACATATTGTCAAGAAAGGTGCTCCATCTGCCAAGGAATCCCGGGATCTTGTAGAAGACAGACAAAGACTTACCGAAACCCTCATCCCTCTCATTCCTCGCCTTATCACAAAGTTCAGCTCGGACAATGAGAAAATTATCAATTTGGTCAACATTCCACTGCACTTTCAGTTAGAAACATACTTATCAGCTCGAATGCAAACGCATCTCATGGAACTCATGGAAGGTCTAGACTCATTGATTGAAAAGCATCTCGATGAAGAATTGCTCAAAGCTGTAGCAGAATTGTACTACCACTTGACAACCAACTCCTCCATTTCTGCTCTCGTCGAAGGCCACAAAATGAAACTTTTGGACGGAGTTGCTGCTTTCATTCGGAAATCTATGCAACAATTTGATGATGATCAGATGGGGGAAGAAGAGGAAGCACTTTTCGTATCCTACATAAAACGAATGGCTGCTTTCGCTGGATTCATGGATCTTCGCCATTGGGATCTTTGGGACATTCTTCTGAAAGTTGTTTCAAACTATACACGCGAAGACACACAACGAGACGTTCGAGAAAGATCAATGCAAATGTTATTCATGCAACTTTGCTTTGATTCAATGAATATCAAGAAAGAAGGAGAAACTCCGAAAGCAGATCAAGTTAGAAAACTGAAGAAACGTAGAGATCAGTTAATTCGAATTGTAACCGAAACATTGAACGAAGAAGCATGCGGAGTCGAACAAGCTTATTTGGTGATCTGTGACCTGATGATCCTTTTCGGAAGTCAACTTGCAGAGGAGTCCAAAGCTCTGGAACCACTGATTTGGCGCCCCGATGCAATGGTTCTTGGAAATCTCAAAATCTTTCTGGACGTAAATGTATTTGATGTAAGCAACTTGGATGATATGGATCAACAAGAGAAGATTGAAGTAATGCACAAAATGCGGCAACACGTTGCACAATACGCTAAGCTTATCATTCACGGAGCCATGCCAGTCGCAGAAGCATCTCATCTCATAAAACGCTATCAGTCTCACTTCCAAGACTTCGGAGACATTTTCAAAAATCTTTTATCAAAGTGCCGTGAAATTTCATTTGTCGAAACTGGCGTCATGATTTGTGAAACTCTTAAAACCCTTTATTCACAATTGGACGAAGATCAAGGAACGGATCCACTGTCAGAGTCATTCAATTCTATTCGTGATCTTGCAAAACGATTAGGACCTGCTTTCGGTGTTGATTATGCTAAGAATCGGTTTGCTATCTCGTCATTGCACAAAAAAGCCATCGATTTTGCATTCGAAGAGTACGATAAAGAAAATCATCAGATGCCGAAAAACATTTTCTTCTTGGAAATTGCTATCGAATTTAGCGGGAAGTTATTGGCACAGGACAAGATGGCTGTCGTTCGTTACTTGAACAAAATTTACACAAACCGCGTTGGAACATCAACAGTCGTTTGGGAACCATATCGATTATACCTCGGATCACTCTCGGATCGTAACGATGATGACAACATGTCTGTGCGCAGTGGAATGACCGTTACATCCAATGCAACTATGAGAAGTACTGCTTCGTCAACACGTGGAAGAGGTCGTGGAAGAGGTCGTTCCAGAATTGCCGATGATTTTTAA
  Experiment: Laboratory: YM
    Date: 01 Jun 2003 00:00:00
    Strain: WBStrain00000001
    Temperature: 20
    Delivered_by: Soaking
  Inhibits: Predicted_gene: F18E2.3 Inferred_automatically: RNAi_primary
    Gene: WBGene00004738 Inferred_automatically: RNAi_primary
    Transcript: F18E2.3.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00005937
  Phenotype: WBPhenotype:0000050 Remark: Depletion of the gene products resulted in embryonic lethality with complete penetrance. RNAi-affected embryos were all arrested during embryogenesis, and ~30% of them displayed defective mitosis in early cell cycles. In wild-type embryos, condensed chromosomes aligned on the metaphase plate and then they separated at once in anaphase, giving a view of splitting two parallel discs. After cytokinesis, chromosomes were decondensed and nuclear membrane was reassembled around them. In contrast, embryos depleted of either SCC-3, or HIM-1/SMC-1, or SMC-3 behaved differently from the wild-type, with these three kinds of RNAi embryos showing phenotypes indistinguishable from each other. Chromosomes were condensed at prometaphase in these embryos, but the metaphase plate often looked diffuse, or was completely missing in some cases. Then, a mass of chromosomes staying in the middle of the bipolar spindle frequently seemed to be divided by a cleavage furrow. This might mean the lack of anaphase, or alternatively, the progression of aberrant anaphase with extensive chromosome bridging, which were not distinguishable at the current resolution. Chromosomes were decondensed after cytokinesis, as in wild-type embryos, but multiple (mainly two to four) nuclei of variable size were often formed in daughter cells. In the case of wild-type embryos, nuclear membrane has been shown to reassemble around subsets of decondensed chromosomes at telophase, but they fuse until they form a single nucleus that encloses the whole chromosome set. Authors speculate that nuclear membrane could reassemble around each chromosome or a subset of a few chromosomes but failed to fuse to form a single nucleus in cells devoid of either SCC-3, or HIM-1/SMC-1, or SMC-3. This is probably because chromosomes were not separated synchronously in these cells and hence were not close enough to each other to compose a unified nucleus. Subsequent cell cycles were also aberrant similarly in the RNAi animals. Nuclear membrane of the multiple small nuclei generated in the previous cell cycle broke down simultaneously and chromosomes were condensed, but only a loose metaphase plate was formed again, and a mass of chromosomes was divided irregularly by a cleavage furrow. These observations suggest that SCC-3, HIM-1/SMC-1, and SMC-3, are essential for proper chromosome segregation, but unlikely to be involved in other aspects of the cell cycle.
      Penetrance: Complete
    WBPhenotype:0000773 Remark: Depletion of the gene products resulted in embryonic lethality with complete penetrance. RNAi-affected embryos were all arrested during embryogenesis, and ~30% of them displayed defective mitosis in early cell cycles. In wild-type embryos, condensed chromosomes aligned on the metaphase plate and then they separated at once in anaphase, giving a view of splitting two parallel discs. After cytokinesis, chromosomes were decondensed and nuclear membrane was reassembled around them. In contrast, embryos depleted of either SCC-3, or HIM-1/SMC-1, or SMC-3 behaved differently from the wild-type, with these three kinds of RNAi embryos showing phenotypes indistinguishable from each other. Chromosomes were condensed at prometaphase in these embryos, but the metaphase plate often looked diffuse, or was completely missing in some cases. Then, a mass of chromosomes staying in the middle of the bipolar spindle frequently seemed to be divided by a cleavage furrow. This might mean the lack of anaphase, or alternatively, the progression of aberrant anaphase with extensive chromosome bridging, which were not distinguishable at the current resolution. Chromosomes were decondensed after cytokinesis, as in wild-type embryos, but multiple (mainly two to four) nuclei of variable size were often formed in daughter cells. In the case of wild-type embryos, nuclear membrane has been shown to reassemble around subsets of decondensed chromosomes at telophase, but they fuse until they form a single nucleus that encloses the whole chromosome set. Authors speculate that nuclear membrane could reassemble around each chromosome or a subset of a few chromosomes but failed to fuse to form a single nucleus in cells devoid of either SCC-3, or HIM-1/SMC-1, or SMC-3. This is probably because chromosomes were not separated synchronously in these cells and hence were not close enough to each other to compose a unified nucleus. Subsequent cell cycles were also aberrant similarly in the RNAi animals. Nuclear membrane of the multiple small nuclei generated in the previous cell cycle broke down simultaneously and chromosomes were condensed, but only a loose metaphase plate was formed again, and a mass of chromosomes was divided irregularly by a cleavage furrow. These observations suggest that SCC-3, HIM-1/SMC-1, and SMC-3, are essential for proper chromosome segregation, but unlikely to be involved in other aspects of the cell cycle.
      Penetrance: Complete
  Remark: paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. Authors used yk97g6 (scc-3).
  Method: RNAi