WormBase Tree Display for RNAi: WBRNAi00087976
expand all nodes | collapse all nodes | view schema
| WBRNAi00087976 | Homol | Homol_homol | Y116F11B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | CAAGCTCATCGCCATCTTTGCCGTACTCGTCCTCTCCGTCTCGGCTCATCTCGGAGCCCAGGCCGCCGCCGCCAACTTCAAGGCCGAGGGCCCACTAAGCCGTGCAGTCCGTGTTCCAGGTGTGGCCGTGAGGGCCTGTGGTCGTCGCCTCGTTCCGTATGTGTGGAGTGTCTGTGGAGACGCCTGTGAACCACAAGAAGGAATTGACATCGCAACACAATGCTGCACCTATCAATGCACTGCCGAGTATATACAAACTGCCTGTTGCCCACGTTTGC | |||
| Experiment | Laboratory | NIS | |||
| Date | 08 Jul 2010 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Treatment | Fourth larval stage animals or young adults were picked to RNAi plates containing 5-fluoro-2-deoxyuridine (Sigma) to prevent the growth of progeny. Worms were tapped every 2-4 days and were scored as dead when they did not move after repeated taps with a pick. | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y116F11B.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000920 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y116F11B.1.2 | Inferred_automatically | RNAi_primary | ||
| Y116F11B.1.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00036470 | ||||
| Phenotype | WBPhenotype:0000061 | Remark | daf-28(RNAi) resulted in a significant increase in life span, compared to wild type controls | ||
| Method | RNAi |
