WormBase Tree Display for RNAi: WBRNAi00087526
expand all nodes | collapse all nodes | view schema
WBRNAi00087526 | Homol | Homol_homol | M01D7:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atggacgtctcccagctgacagatgccgaactacgcgatagccttaaaagccacggggtttctgttgggccaattgtggcgacgacccgcaagctctacgagaagaagcttatcaagttatcagacggaagcattaacaatcaatcaaatctcaacgactctcaattcaacgaggattcattgatcatcagctcgtcaccgaagaaatcaccgccacaacgagttttccagaacgtgtcagctgcaacagcggcagctactacctctcccgaatcggacagcgacgattgcgaggagtcgatgcgatacttgacggaagaggaaatggccgccgatcgggcatcggctcgtcaagctcagagcaacaaaggaggattcttgggaagcacgatcacattcacaattctcttcgtcttcatcgccgtcttcgcctacttcttgatcgagaacgccgagcagttgaagctcgtggccgagacgaatccggaggatactatttaa | |||
Experiment (3) | |||||
Inhibits | Predicted_gene | M01D7.6 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00001309 | Inferred_automatically | RNAi_primary | ||
Transcript | M01D7.6.2 | Inferred_automatically | RNAi_primary | ||
M01D7.6.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005158 | ||||
Phenotype_not_observed | WBPhenotype:0000145 | ||||
WBPhenotype:0000531 | Remark | The emr-1(RNAi) embryos with no detectable Ce-emerin developed at normal rates into fertile adult nematodes. The emerin-depleted adults had no detectable phenotype: they displayed normal movement and feeding behavior, and produced viable fertile offspring: emr-1(RNAi) animals and control N2 animals had similar brood sizes (averaging 206 for emr-1(RNAi) and 208 for N2; n=5), and aged at similar rates (50-58% not moving well and 35% dead by day 23, and all dead by day 26 at 20oC; n=20 each). | |||
WBPhenotype:0000643 | |||||
WBPhenotype:0000659 | |||||
WBPhenotype:0000673 | |||||
Method | RNAi |