WormBase Tree Display for RNAi: WBRNAi00087525

WBRNAi00087525 Homol: Homol_homol: DY3:RNAi
  Sequence_info: DNA_text: atgtcatctcgtaaaggtactcgtagttctcgtattgttacgctagagcgctcagcgaattcgtcgctaagcaacaatggaggaggcgacgattcatttggctcaacgcttctagaaacttcacgtcttcaagagaaagatcatttgacttcactcaacagtcgtcttgccacttacatcgacaaagttcgtcaattggagcaagagaacaacagactccaggttcaaattcgcgacatcgaagttgttgaaaagaaagagaagtcaaacttggccgatcgcttcgaggcggaaaaggctcgtctccgtcgtgccctcgattcggctcaagatgagctcgcaaaatacaggatcgagtatgacgctgcaaaggttgaagtaaagaagttgaagccacaagtcgaaaaacttgagagagaactcgctggagctgaggaacaagccctccatgcccaatctattgctgatcaaagtcaagcaaaacagaagacgttgcaggcacgcaacgataaattggtggtggagaatgatgatctcaaaaagcagaacatcactcttcgtgacaccgtagaaggactcaagaaagccgttgaagatgaaactcttctccgaacagccgccaacaataaaatcaaggctctggaagaagatctcgcttttgctcttcaacagcacaagggagaacttgaagaagttcgtcacaagagacaggtcgacatgacaacctacgccaagcagattaatgatgagtatcaatctaagcttcaagatcaaatcgaagagatgcgtgctcagttcaagaacaatttgcatcaaaacaaaacagctttcgaagatgcctacaaaaacaagctcaatgctgctcgtgaacgccaagaggaggctgtatccgaagcaatccatcttcgtgcccgtgttcgtgacttggagacatcaagcagtggaaatgcttcgctcatcgaacgtcttcgttcagagctcgacactctgaagagatcgttccaagagaagctcgacgacaaggatgctcgaattgctgaacttaatcaagagatcgagcgcatgatgagcgagttccacgatcttcttgatgttaaaatccaattggacgccgaactcaagacctaccaagctctccttgagggtgaggaggagcgtctcaatcttactcaggaggcgccacaaaacacttcagttcatcacgtctcgttttcatccggaggagcaagcgctcagcgcggagtgaagcgtcgtcgcgttgtcgatgtaaatggagaggaccaagacattgattatctcaaccgtcgctccaaactcaacaaagagactgttggcccagttggaatcgacgaggttgatgaggaaggaaagtgggtccgtgttgcaaacaactctgaagaagaacaatccatcggaggatacaagttggtggtcaaagctggaaacaaagaagcctccttccaattttcatctcgtatgaagctcgctccacatgctagcgccaccgtttggtctgcggatgctggtgccgttcaccacccaccagaagtctacgttatgaagaagcaacagtggccaattggagataacccatcagctcgtcttgaggatagtgaaggagacactgtttcttctatcaccgttgaattcagcgaatcatcggatccatcggacccagccgatcgttgttccatcatgtaa
  Experiment: Laboratory: YG
    Date: 01 Nov 2000 00:00:00
    Strain: WBStrain00000001
    Delivered_by: Injection
  Inhibits: Predicted_gene: DY3.2 Inferred_automatically: RNAi_primary
    Gene: WBGene00003052 Inferred_automatically: RNAi_primary
    Transcript: DY3.2.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00004416
  Phenotype: WBPhenotype:0000050 Remark: RNAi effects are most potent in a time window of 18 to 36 h after injection. All embryos laid during this time window arrested during development, indicating lamin is required for embryonic viability. Although some lmn-1(RNAi) embryos arrested with <100 nuclei, DIC microscopy revealed that most lmn-1(RNAi) embryos were able to form several hundred nuclei before arrest. All lmn-1(RNAi) embryos were abnormal and contained nuclei that varied in size. Further incubation of the lmn-1 (RNAi) embryos caused them to degrade and to form regions in the embryos that were devoid of nuclei. The phenotype of lmn-1(RNAi) embryos was examined by 4D time-lapse microscopy on live embryos. The earliest observed defect was as early as the two-cell stage. While nuclei in the wild-type embryo had well defined and stable boundaries, the nuclei in lmn-1(RNAi) embryos appeared plastic, with rapid changes over time. Despite the gross defects in nuclear morphology, nuclear divisions still occurred in lmn-1(RNAi) embryos, with these embryos eventually producing several hundred cells. The nuclear morphology of the lmn-1 (RNAi) embryos was further examined by staining with the DNA-specific dye DAPI. Whereas control embryos of mock-injected hermaphrodites or wild-type embryos had no apparent nuclear abnormalities, a fraction of nuclei in >95% of the lmn-1 (RNAi) embryos appeared abnormal, with defects as early as the first few nuclear divisions. These phenotypes included inability to complete the cell cycle and distribution of unequal amounts of chromatin into the daughter nuclei. The most common phenotypes in the progression of the cell cycle were bridges of chromatin between nuclei and chromatin that expanded abnormally. Problems in the distribution of chromatin between daughter nuclei included large differences in the amounts of chromatin in the daughter nuclei and chromosomes that were outside the daughter nuclei. These abnormalities were not due to gross defects in microtubule organization, since the pattern of staining of the lmn-1 (RNAi) embryos with tubulin antibodies was similar to that of wild-type embryos. Arrested embryos showed regions where the DNA was absent, or regions with a large increase in the amount of DNA.
    WBPhenotype:0001028
    WBPhenotype:0001378
    WBPhenotype:0001392
  Remark: Three different constructs were used for making double-stranded RNA in vitro. yk63f8, contained a 2.13-kb, nearly full-length, lmn-1 cDNA; pJKL253.1 contained a 659-bp PCR fragment from exon 5 (the largest exon) of the lmn-1 gene; pPRNA-1 contained a 995-bp BglII-EcoRI fragment of the lmn-1 gene (amino acids 217 to 550). Equivalent results were obtained with three different dsRNA constructs, injected at several different concentrations (0.1 to 1.0 ug/ul).
  Method: RNAi