WormBase Tree Display for RNAi: WBRNAi00086919
expand all nodes | collapse all nodes | view schema
| WBRNAi00086919 | Homol | Homol_homol | C32D5:RNAi | ||
|---|---|---|---|---|---|
| C06G4:RNAi | |||||
| Sequence_info | DNA_text | gtcttcttcgtttattcatgaatcaaaaatttgaaagtaatagcaaaaaaatatcaaaatccgagagaaaacatgattttctgggaggggagaagagcaacttcgtagacaatagtttgaatagaagtcactactcggaaccgtcatacgagaaaaatgagaagaaaatgtgaaggaaatacagaattattacagaaaatgagaagatttttttaaaggggctttgggtttccattagaagtatgaaatttccattgtacaagtatacacattcgtcggcggataatacatgacactttattccttcttttcgacctctcctccatacacactttcgtcactgtaggcgatgtaaaggaacaagtcttcctcgtgatggtcctgtaataaagaaaagggttaattaaatgaaaataaacgactggttagttacctggtagagttgtcccattgtggtcatggtttgtggaatgacattgttgacaaagaagaacagagcatcttctggacgaagttggatgcgttttctgatgaggaagtagaactgtccaacagtaagatcggatgggaccaagtacttcttcttatccaagtcatggagctttgactttggtgctttctcaacaatcactggaatacggtctgggtactttctgcggatcttgtctccttcggcacgacgcttctcaaagttgttctcctccttgtaagcccactt | |||
| PCR_product | sjj_C06G4.2 | ||||
| Experiment | Laboratory | IE | |||
| Date | 20 Aug 2007 00:00:00 | ||||
| Genotype | lin-35(n745); mec-4(u231) | ||||
| Treatment | To augment RNAi, animals were reared for two generations on dsRNA-producing E. coli bacteria before examination | ||||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C06G4.2a | Inferred_automatically | RNAi_primary | |
| C06G4.2d | Inferred_automatically | RNAi_primary | |||
| C06G4.2b | Inferred_automatically | RNAi_primary | |||
| C32D5.9 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00000542 | Inferred_automatically | RNAi_primary | ||
| WBGene00002980 | Inferred_automatically | RNAi_primary | |||
| Transcript | C06G4.2d.1 | Inferred_automatically | RNAi_primary | ||
| C06G4.2a.2 | Inferred_automatically | RNAi_primary | |||
| C32D5.9.1 | Inferred_automatically | RNAi_primary | |||
| C06G4.2c.1 | Inferred_automatically | RNAi_primary | |||
| C06G4.2b.2 | Inferred_automatically | RNAi_primary | |||
| C06G4.2a.1 | Inferred_automatically | RNAi_primary | |||
| C06G4.2b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031045 | ||||
| Phenotype_not_observed | WBPhenotype:0000415 | Remark | The number of touch receptor neuron cell corpses at the L1 larval stage resulting from the mec-4(u231) mutation [a.k.a. mec-4(d)] was not further decreased compared to lin-35(n745);mec-4(d) control animals | ||
| Remark | Exact sequence used for RNAi not stated by authors, Ahringer laboratory clone used for curation. | ||||
| Method | RNAi |
