WormBase Tree Display for RNAi: WBRNAi00086602
expand all nodes | collapse all nodes | view schema
| WBRNAi00086602 | Homol | Homol_homol | C32D5:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | gggcttacaaggaggagaacaactttgagaagcgtcgtgccgaaggagacaagatccgcagaaagtacccagaccgtattccagtgattgttgagaaagcaccaaagtcaaagctccatgacttggataagaagaagtacttggtcccatccgatcttactgttggacagttctacttcctcatcagaaaacgcatccaacttcgtccagaagatgctctgttcttctttgtcaacaatgtcattccacaaaccatgaccacaatgggacaactctaccaggaccatcacgaggaagacttgttcctttacatcgcctacagtgacgaaagtgtgtatggaggagaggtcgaaaagaagg | ||||
| Experiment | Laboratory | TTV | ||||
| Date | 10 Jan 2007 00:00:00 | |||||
| Genotype | deg-1(u506) | |||||
| Temperature | 20 | |||||
| Delivered_by | Bacterial_feeding | |||||
| Inhibits | Predicted_gene | C32D5.9 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00002980 | Inferred_automatically | RNAi_primary | |||
| Transcript | C32D5.9.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | |||||
| Interaction | WBInteraction000500885 | |||||
| Reference | WBPaper00029139 | |||||
| Phenotype | WBPhenotype:0000179 | Remark | RNAi of lgg-1 partially suppresses the PVC neuron vacuolization and death caused by the deg-1(u506) mutation | |||
| EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | |||
| Method | RNAi |
