WormBase Tree Display for RNAi: WBRNAi00085648
expand all nodes | collapse all nodes | view schema
| WBRNAi00085648 | Homol | Homol_homol | C39E9:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | tttcgggcatggacaatactgaaaatttccatttttaatgaaataaaaacttcttcagaatatctctcacttaccaatgcatcttgaccattcggcccaatgggtccagattctccaacatctcctgtagatccagttcttccagggggaccttgaagaccaatagaacccaacggtccatccacaccaagacctccacgatttcctcgatctccttccattccaacaggaccaacgggtcctggagcaccaataggtcctcgtactcctttttcgcgaacggtatccataccacgtctaccgattgcaccagctggtccgggaggtcccgcttgaccacaaggtcccagttctccattatgtcccggtgctccgttgttaccgggagttcctgcgccgccagattgtccacgttgacctcgtggtccgatctttccaggcgcacctgggggccccatttctccggctggacaatactgacatcctggatctacatgcattgtttgaacatcacccg | |||
| Experiment | Laboratory | OD | |||
| Date | 24 Mar 2011 00:00:00 | ||||
| Strain | WBStrain00029219 | ||||
| Treatment | Larval L4 stage worms were soaked in dsRNA for 24 hrs at 20C. After soaking, the worms were transferred to NGM plates seeded with OP50 E. coli and allowed to recover for 48 hrs prior to imaging. | ||||
| Temperature | 20 | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene | C39E9.3 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000705 | Inferred_automatically | RNAi_primary | ||
| Transcript | C39E9.3.1 | Inferred_automatically | RNAi_primary | ||
| DB_info | Database | Phenobank2 | Gene&RNAID | GeneID=504854 | |
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00038381 | ||||
| Phenotype | WBPhenotype:0000688 | ||||
| WBPhenotype:0001260 | Remark | Oocytes are rounded. | |||
| WBPhenotype:0001941 | |||||
| WBPhenotype:0001944 | |||||
| WBPhenotype:0001950 | Remark | Shortened diplotene region. | |||
| WBPhenotype:0001951 | Remark | Pachytene extends to the turn in the gonad. | |||
| WBPhenotype:0001980 | Remark | Delayed compartment expansion at turn in gonad. | |||
| WBPhenotype:0001982 | Remark | Internal PI4,5P2 debris in germ cells. PI4,5P2 is phosphatidylinositol 4,5-bisphosphate which is normally a phospolipid component of cell membranes. | |||
| PI4,5P2 accumulation in cytoplasm or nucleus of germ cells. PI4,5P2 is phosphatidylinositol 4,5-bisphosphate which is normally a phospolipid component of cell membranes. | |||||
| Remark | Experiment SS336 | ||||
| Method | RNAi |
