WormBase Tree Display for RNAi: WBRNAi00082137
expand all nodes | collapse all nodes | view schema
WBRNAi00082137 | Homol | Homol_homol | Y43C5A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ggaggtggtgagggaaaatgtatgtatattgataccaatgccacttttcgacccgaacgaattattgctatcgctcagagatacaatatggacagtgctcatgtactcgagaatatcgctgttgcacgtgcatacaactcagaacatttgatggctttgattattcgagcaggagcaatgatgtccgagagtcgttatgctgttgtgattgttgactgtgcaactgctcatttccgtaacgaatacactggaagaggagatctagcggaacgtcagatgaagctctctgcttttctgaaatgccttgccaagcttgccgatgaatatggtgtcgctgtaattattaccaatcaagttgtagcacaagtcgacggaggagcctcgatgttccaggctgatgctaaaaagcccattggaggtcacatcatcg | |||
Experiment | Date | 26 Nov 2001 00:00:00 | |||
Genotype | msh-5(me23) | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene (3) | ||||
Gene | WBGene00004297 | Inferred_automatically | RNAi_primary | ||
Transcript | Y43C5A.6c.1 | Inferred_automatically | RNAi_primary | ||
Y43C5A.6a.1 | Inferred_automatically | RNAi_primary | |||
Y43C5A.6b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000051720 | ||||
Reference | WBPaper00005134 | ||||
Phenotype | WBPhenotype:0001233 | Remark | Small spots with DAPI stain show DNA fragmentation when rad-51 RNAi is done in the msh-5(me23). This phenotype is synthetic as it is not seen in either background alone. | ||
WBPhenotype:0001348 | Remark | Small spots with DAPI stain show DNA fragmentation when rad-51 RNAi is done in the msh-5(me23). This phenotype is synthetic as it is not seen in either background alone. | |||
Method | RNAi |