WormBase Tree Display for RNAi: WBRNAi00082135
expand all nodes | collapse all nodes | view schema
| WBRNAi00082135 | Homol | Homol_homol | Y43C5A:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ggaggtggtgagggaaaatgtatgtatattgataccaatgccacttttcgacccgaacgaattattgctatcgctcagagatacaatatggacagtgctcatgtactcgagaatatcgctgttgcacgtgcatacaactcagaacatttgatggctttgattattcgagcaggagcaatgatgtccgagagtcgttatgctgttgtgattgttgactgtgcaactgctcatttccgtaacgaatacactggaagaggagatctagcggaacgtcagatgaagctctctgcttttctgaaatgccttgccaagcttgccgatgaatatggtgtcgctgtaattattaccaatcaagttgtagcacaagtcgacggaggagcctcgatgttccaggctgatgctaaaaagcccattggaggtcacatcatcg | |||
| Experiment | Date | 26 Nov 2001 00:00:00 | |||
| Genotype | rad-5(mn159) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y43C5A.6b | Inferred_automatically | RNAi_primary | |
| Y43C5A.6a | Inferred_automatically | RNAi_primary | |||
| Y43C5A.6c | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004297 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y43C5A.6c.1 | Inferred_automatically | RNAi_primary | ||
| Y43C5A.6a.1 | Inferred_automatically | RNAi_primary | |||
| Y43C5A.6b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051719 | ||||
| Reference | WBPaper00005134 | ||||
| Phenotype_not_observed | WBPhenotype:0000673 | Remark | The rad-5(mn159) mutation suppresses the reduced brood size seen with rad-51 dsRNA. This is not suppressed by ced-3. | ||
| Method | RNAi |
