WormBase Tree Display for RNAi: WBRNAi00082134
expand all nodes | collapse all nodes | view schema
WBRNAi00082134 | Homol | Homol_homol | Y43C5A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ggaggtggtgagggaaaatgtatgtatattgataccaatgccacttttcgacccgaacgaattattgctatcgctcagagatacaatatggacagtgctcatgtactcgagaatatcgctgttgcacgtgcatacaactcagaacatttgatggctttgattattcgagcaggagcaatgatgtccgagagtcgttatgctgttgtgattgttgactgtgcaactgctcatttccgtaacgaatacactggaagaggagatctagcggaacgtcagatgaagctctctgcttttctgaaatgccttgccaagcttgccgatgaatatggtgtcgctgtaattattaccaatcaagttgtagcacaagtcgacggaggagcctcgatgttccaggctgatgctaaaaagcccattggaggtcacatcatcg | |||
Experiment (3) | |||||
Inhibits | Predicted_gene | Y43C5A.6b | Inferred_automatically | RNAi_primary | |
Y43C5A.6a | Inferred_automatically | RNAi_primary | |||
Y43C5A.6c | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004297 | Inferred_automatically | RNAi_primary | ||
Transcript | Y43C5A.6c.1 | Inferred_automatically | RNAi_primary | ||
Y43C5A.6a.1 | Inferred_automatically | RNAi_primary | |||
Y43C5A.6b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000051718 | ||||
Reference | WBPaper00005134 | ||||
Phenotype_not_observed | WBPhenotype:0001348 | Remark | Properly condensed univalents in diakinesis nuclei. No defective chromosome structures like those observed with rad-51 RNAi alone. Authors state that this observation provides evidence that mre-11 is necessary in C. elegans in the initial steps of recombination for double-strand break (DSB) induction. | ||
Method | RNAi |