WormBase Tree Display for RNAi: WBRNAi00082133
expand all nodes | collapse all nodes | view schema
WBRNAi00082133 | Homol | Homol_homol | Y43C5A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ggaggtggtgagggaaaatgtatgtatattgataccaatgccacttttcgacccgaacgaattattgctatcgctcagagatacaatatggacagtgctcatgtactcgagaatatcgctgttgcacgtgcatacaactcagaacatttgatggctttgattattcgagcaggagcaatgatgtccgagagtcgttatgctgttgtgattgttgactgtgcaactgctcatttccgtaacgaatacactggaagaggagatctagcggaacgtcagatgaagctctctgcttttctgaaatgccttgccaagcttgccgatgaatatggtgtcgctgtaattattaccaatcaagttgtagcacaagtcgacggaggagcctcgatgttccaggctgatgctaaaaagcccattggaggtcacatcatcg | |||
Experiment | Date | 26 Nov 2001 00:00:00 | |||
Genotype | spo-11(ok79) | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | Y43C5A.6b | Inferred_automatically | RNAi_primary | |
Y43C5A.6a | Inferred_automatically | RNAi_primary | |||
Y43C5A.6c | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004297 | Inferred_automatically | RNAi_primary | ||
Transcript | Y43C5A.6c.1 | Inferred_automatically | RNAi_primary | ||
Y43C5A.6a.1 | Inferred_automatically | RNAi_primary | |||
Y43C5A.6b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000051717 | ||||
Reference | WBPaper00005134 | ||||
Phenotype_not_observed | WBPhenotype:0001348 | Remark | Properly condensed univalents, such as those displayed by the spo-11 oocytes in the presence of a functional rad-51, are observed. No defective chromosome structures like those observed with rad-51 RNAi alone. Authors state that this shows rad-51 acts downstream of spo-11 during meiotic prophase. | ||
Method | RNAi |