WormBase Tree Display for RNAi: WBRNAi00082055
expand all nodes | collapse all nodes | view schema
WBRNAi00082055 | Homol | Homol_homol | F17E9:RNAi | ||
---|---|---|---|---|---|
F54E12:RNAi | |||||
ZK131:RNAi | |||||
F35H10:RNAi | |||||
B0035:RNAi | |||||
F08G2:RNAi | |||||
H02I12:RNAi | |||||
F55G1:RNAi | |||||
T23D8:RNAi | |||||
Sequence_info | DNA_text | atgtctggacgtggaaagggaggcaaagccaagaccggaggaaaggccaagtcccgctcatcaagagccggactccaattcccagttggtcgtcttcaccgtattcttcgcaaaggaaactacgctcaacgcgtcggagccggagccccagtctacttggccgctgttctcgaatacctcgctgctgaggttctcgagttggccggtaacgctgcccgtgataacaagaagacccgtatcgccccaagacatcttcaacttgccgtccgtaatgacgaagagttgaacaaacttttggctggagtcacaatcgctcaaggaggagttcttccgaacatccaagctgttcttcttccaaagaagaccggtggagataaggaataa | |||
Experiment | Laboratory | YM | |||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | F08G2.2 | Inferred_automatically | RNAi_primary | |
ZK131.6 | Inferred_automatically | RNAi_primary | |||
ZK131.10 | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001890 | Inferred_automatically | RNAi_primary | ||
WBGene00001886 | Inferred_automatically | RNAi_primary | |||
WBGene00001917 | Inferred_automatically | RNAi_primary | |||
Transcript | ZK131.6.1 | Inferred_automatically | RNAi_primary | ||
F08G2.2.1 | Inferred_automatically | RNAi_primary | |||
ZK131.10.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005085 | ||||
Phenotype | WBPhenotype:0000241 | ||||
WBPhenotype:0000242 | |||||
WBPhenotype:0000707 | Remark | Detached pharynxes at the terminal stage. | |||
WBPhenotype:0000867 | Remark | Embryos arrest with around 50 cells in both cases. | |||
WBPhenotype:0010004 | Remark | Appearance and elimination of cell corpses is delayed. | |||
Method | RNAi |