WormBase Tree Display for RNAi: WBRNAi00080213
expand all nodes | collapse all nodes | view schema
| WBRNAi00080213 | Homol | Homol_homol | C35C5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ggagacggaacagttggaaaaacatgcatgttaatatcttacacaactgactcttttccagttcagtatgtgcctacagtatttgataactattcggcacagatgagtcttgatgggaacgttgtgaacttaggattgtgggatactgctggacaggaggattatgatcgtttacgaccactttcctacccacagacggatgttttcattctctgcttctctgtcgtctcgcccgtatcgtttgacaatgtggcaagcaagtggattccggaaatacgacagcattgtccagatgcgcctgtcattctagttggtaccaaactcgatttgcgcgacgaggccgaaccgatgcgtgctctgcaggccgaaggaaagtccccaatttccaaaacgcaaggcatgaaaatggctcaaaaaattaaagctgtcaagtatttggaatgctctgcattgacgcaacagggactcacacaggtgttcgaagacgccgtacggtccattcttcatccgaaacc | |||
| Experiment | Laboratory | OD | |||
| Date | 24 Oct 2008 00:00:00 | ||||
| Treatment | After injection, worms were allowed to recover for 44-50 hrs at 16C prior to filming | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C35C5.4b | Inferred_automatically | RNAi_primary | |
| C35C5.4a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003239 | Inferred_automatically | RNAi_primary | ||
| Transcript | C35C5.4b.1 | Inferred_automatically | RNAi_primary | ||
| C35C5.4a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00032405 | ||||
| Phenotype_not_observed | WBPhenotype:0001129 | Remark | RNAi of mig-2 does not affect the cleavage furrow or cytokinesis | ||
| Method | RNAi |
