WormBase Tree Display for RNAi: WBRNAi00079646
expand all nodes | collapse all nodes | view schema
WBRNAi00079646 | Homol | Homol_homol | Y38C1AA:RNAi | |||
---|---|---|---|---|---|---|
Sequence_info | DNA_text | atgtcactgtgtggctcagttctttgtataaaatgttcgttagtattcgacgagaaaactagacgaccatgtacgggtacttgcaatcattcaatttgtgaacaatgtttcgatcaaaaacattccccttcatgcccaatttgcaacaacatagactcattccaaactaagaatatcaattggaaggcggtcgaaattatggaggagttgtcgaaaaacaaggattatttgagcattgataatttcaagtacaacccagatgctctctgcgctggaacatgctcggaatgcaaaactcacactgacaaacttcgaatttgtgttgactgtttgacacggtcaggacacgtagcgaaaactgaaaatggcaactttgaaatgtctcaagactcgtcgactgactatccggatagctcggcgttgcaagtattaagcaccggaatgtgtgcggattgttgtattgatggggctcataaggaacatgaaatcaccccgataaagcaatttgtttcattattgagacggtttgagaacttaaacacattgtcagccatctcccttgacttgctgactccatacaatgatcttgaagacaaatcagacctagaagttatgaatctgtatttgaaactggttgaaaaaatagttttcaaatttcaagaatggattgacaacgcttttcaaggatcagtacaaactgatgcaacgagagttgcaatgaagcgatcaacggaaagacttcattactttgttcaaaaatgcaacccagtaataattcaatgtgtatccgaaattctagaatctgctagtgaaaaagatcaaaaggagtggcaggaaatcaatcagaaactcgaagaataccagaatactgtatcttcagcagataagtatactgaactaggtgccagagatttccaacttattgacacggtgttggagtgtttcaatgaagatgatgaagatagcgatgtaatagaagatgatatggaactcgattga | ||||
Experiment | Laboratory | MV | ||||
Date | 23 Dec 2003 00:00:00 | |||||
Genotype | daf-5(e1386) | |||||
Treatment | Single L4 animals were fed bacteria carrying double-stranded RNA expression constructs and allowed to develop for 24 hours at 15 C. Animals were shifted to the assay temperature (25 C or 27 C) when gravid, and the Po animals were removed 1418 hr later. Progeny were assayed for the dauer phenotype approximately 48 hr thereafter. | |||||
Temperature | 25 | |||||
Delivered_by | Bacterial_feeding | |||||
Inhibits | Predicted_gene | Y38C1AA.6 | Inferred_automatically | RNAi_primary | ||
Gene | WBGene00021397 | Inferred_automatically | RNAi_primary | |||
Transcript | Y38C1AA.6.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | |||||
Interaction | WBInteraction000051158 | |||||
Reference | WBPaper00006425 | |||||
Phenotype_not_observed | WBPhenotype:0000012 | Remark | No effect on rate of dauer formation compared to no RNAi control | |||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | |||
Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | |||||
Method | RNAi |