WormBase Tree Display for RNAi: WBRNAi00078516
expand all nodes | collapse all nodes | view schema
| WBRNAi00078516 | Homol | Homol_homol | F53A2:RNAi | ||
|---|---|---|---|---|---|
| Y57A10A:RNAi | |||||
| Sequence_info | DNA_text | atgactgaaacggagcaaacgacggcacccatttatccgctgaagcgtaactggacgtggtggtatttgaacgatgagcgcaacaagtcttgggaggatcgtctgaagaaggtgtacaccttcaacaccgtctcggagttctgggctctctacgatgctatccgtccaccaagtggcctcaacgcgttgtgcgattacaacgttttccgtgacgatattcagccgatgtgggaggttccggaaaactcgaacggaggacgctggctcatcgtcattgacaagggaaagactcccgaaatggtcgatgctatttggctggagattctcatggctttggtcggcgagcaattcggaaaggacatggagtcgatttgtgggttggtgtgcaacgtcagaggaaaaggatcgaagatcagcgtctggactaaggattgcaacgatgatgaaaccaacatgaggattggagttgtgctgaaggagaagctgatggccgcatccaaggaccactcaaagccactgttcgatgtgatccgctacgaagatcatgagagctgccagaagaagaccagctcggttgtgaaagccaagctttcattgcactcgtccgatgctccagtcgccgagaaatccgccgtctaa | |||
| Experiment | Laboratory | SS | |||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F53A2.6a | Inferred_automatically | RNAi_primary | |
| F53A2.6b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002059 | Inferred_automatically | RNAi_primary | ||
| Transcript | F53A2.6b.1 | Inferred_automatically | RNAi_primary | ||
| F53A2.6a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004940 | ||||
| Phenotype | WBPhenotype:0000670 | Remark | Defects in spermatogenesis, specifically IFE-1 is necessary for progression through the meiotic divisions and for the production of functional sperm, in both hermaphrodites and males. | ||
| Method | RNAi |
