WormBase Tree Display for RNAi: WBRNAi00078514
expand all nodes | collapse all nodes | view schema
WBRNAi00078514 | Homol | Homol_homol | F53A2:RNAi | ||
---|---|---|---|---|---|
Y57A10A:RNAi | |||||
Sequence_info | DNA_text | atgactgaaacggagcaaacgacggcacccatttatccgctgaagcgtaactggacgtggtggtatttgaacgatgagcgcaacaagtcttgggaggatcgtctgaagaaggtgtacaccttcaacaccgtctcggagttctgggctctctacgatgctatccgtccaccaagtggcctcaacgcgttgtgcgattacaacgttttccgtgacgatattcagccgatgtgggaggttccggaaaactcgaacggaggacgctggctcatcgtcattgacaagggaaagactcccgaaatggtcgatgctatttggctggagattctcatggctttggtcggcgagcaattcggaaaggacatggagtcgatttgtgggttggtgtgcaacgtcagaggaaaaggatcgaagatcagcgtctggactaaggattgcaacgatgatgaaaccaacatgaggattggagttgtgctgaaggagaagctgatggccgcatccaaggaccactcaaagccactgttcgatgtgatccgctacgaagatcatgagagctgccagaagaagaccagctcggttgtgaaagccaagctttcattgcactcgtccgatgctccagtcgccgagaaatccgccgtctaa | |||
Experiment | Laboratory | SS | |||
Treatment | Experiments done at 16, 20 and 25C | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | F53A2.6a | Inferred_automatically | RNAi_primary | |
F53A2.6b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00002059 | Inferred_automatically | RNAi_primary | ||
Transcript | F53A2.6b.1 | Inferred_automatically | RNAi_primary | ||
F53A2.6a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004940 | ||||
Phenotype | WBPhenotype:0000154 | Remark | Experiments done at 16, 20 and 25C, all have a lower brood size, but most severe at 25C. | ||
WBPhenotype:0000688 | Remark | Experiments done at 16, 20 and 25C, all have a lower brood size, but most severe at 25C. | |||
Method | RNAi |