WormBase Tree Display for RNAi: WBRNAi00078225
expand all nodes | collapse all nodes | view schema
| WBRNAi00078225 | Homol | Homol_homol | C26E6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgagctcttctgatttgggaagaggatttaaacaaggccgtggaactggtgattctgggcaatcttctctgtacaacaatgagcgtcgctggaaagatgacgacactttcaatgctctcggagcaaccgatgaattgtcttcatttcttggtgtctgtggagcatctgctcaaaacgatggttcaatgagcgatgtagtggagacattaacacgccttcaatgttgtctacaggatgttggagctcatcttgctactccaccaaaaaattcttcggagagaaaacaaaagaaaactgcattcgatattgcaatggttgaatggataaatgcagaaatcgatcgatacggagacgcgttgcctgcaatccgacaatttattctttctggcggtggaatgacgtctgctcaattacagtattcccgcgcaatttgtcgtcgagctgaacggagtattgttccacttatgagagacgaagacgtcgatccaatggcattaaagttcttgaatagaatgagcgatcttctatttgttctcggtcgtactgcctgcatgagaaacaagaacgaagagctgacatatcttcgccccgattcgttcaccaatttgaaatgggatcgtaaatctcttcacgagaaaaaataa | |||
| Experiment | Date | 02 Jun 2006 00:00:00 | |||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C26E6.11 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00016144 | Inferred_automatically | RNAi_primary | ||
| Transcript | C26E6.11.2 | Inferred_automatically | RNAi_primary | ||
| C26E6.11.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00027754 | ||||
| Phenotype | WBPhenotype:0000027 | Remark | RNAi caused the accumulation of methylmalonic acid at 2-3 times the levels seen in the wild-type nematodes. | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
