WormBase Tree Display for RNAi: WBRNAi00077986
expand all nodes | collapse all nodes | view schema
| WBRNAi00077986 | Homol | Homol_homol | CHROMOSOME_IV:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gacgagctgctcaaagagaacaatgagctgaaaagctcatcggtctcatcgggaaaagcctcaccatcaccggcagagtcgaggagctctccgaagcttgtcgagacagtagtcgctccagtatcaggagcccggaagcggaagcccaaggagcggagcccaccggcagctgcgagtccacttccagacttttcgaatttgatgaacggattcatgtttgatcctctgaatatgtcaaatccaaatggaatgatgcaattattatcaatggttcaacagcagcagcagcagcaacaacaccaccagcacattgagaatcaacaatccgtgagcccaccacaatcgaaatccgtgaaaattgaagatccaatggatcaggatgtgaaacaggaagagtcggagcgatccgatatcccgacggctacagaggcgcagaaccttttggatgcactaacagcacagtttagcagcaacggacaggcgacctccaccacatctccaccatcatcatcatcccaagtacaagcggtcatcgaagcagtcgccacaccatcatcccaaagccaagacagttcaatgtttgagaaaaccgagacgagtggtgatccgaacgcggcgcgatgctccaactgccgaaccgacaagacaaccgcgtggcgacgtgacgccgaggggaagcttgtctgcaatccgtgtgggctctactatcgattgcacaaggttcgccgaccaatagaaatgcgcaaaaaccacatccaacaacgctaccgccgaaagaacaaggaaaaagagtcgtcggcggcaacacagatcttcaaccaactcctcacacaaatgccgacgatggcgaccggcggagtgagcactgatggagccatcaacacattcaatttactcgagcaaatctcgcaattc | |||
| Experiment | Laboratory | JR | |||
| Date | 16 May 2001 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F55A8.1a | Inferred_automatically | RNAi_primary | |
| F55A8.1b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001186 | Inferred_automatically | RNAi_primary | ||
| Transcript | F55A8.1b.1 | Inferred_automatically | RNAi_primary | ||
| F55A8.1a.2 | Inferred_automatically | RNAi_primary | |||
| F55A8.1a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004833 | ||||
| Phenotype | WBPhenotype:0000811 | Remark | Seam cells fail to differentiate properly. Authors used various markers to observe the expression of seam specific NR genes. Expression of three NR reporters, nhr-75 ::GFP, nhr-81 ::GFP,and NHR-82::GFP, was undetectable in all elt-5(RNAi) embryos examined. In contrast, expression of two NR reporters, nhr-73 ::GFP and nhr-74 ::GFP, was only slightly affected, both in terms of the fraction of expressing animals and the level of GFP signal.. The remaining three NR reporters, nhr-72 ::GFP, nhr-77 ::GFP, and nhr-89 ::GFP, gave intermediate results; these were expressed much less frequently in elt-5(RNAi) embryos than in wild-type embryos, and expression was barely detectable in only a few cells for those embryos showing any expression. | ||
| Method | RNAi |
