WormBase Tree Display for RNAi: WBRNAi00077983
expand all nodes | collapse all nodes | view schema
| WBRNAi00077983 | Homol | Homol_homol | CHROMOSOME_IV:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gacgagctgctcaaagagaacaatgagctgaaaagctcatcggtctcatcgggaaaagcctcaccatcaccggcagagtcgaggagctctccgaagcttgtcgagacagtagtcgctccagtatcaggagcccggaagcggaagcccaaggagcggagcccaccggcagctgcgagtccacttccagacttttcgaatttgatgaacggattcatgtttgatcctctgaatatgtcaaatccaaatggaatgatgcaattattatcaatggttcaacagcagcagcagcagcaacaacaccaccagcacattgagaatcaacaatccgtgagcccaccacaatcgaaatccgtgaaaattgaagatccaatggatcaggatgtgaaacaggaagagtcggagcgatccgatatcccgacggctacagaggcgcagaaccttttggatgcactaacagcacagtttagcagcaacggacaggcgacctccaccacatctccaccatcatcatcatcccaagtacaagcggtcatcgaagcagtcgccacaccatcatcccaaagccaagacagttcaatgtttgagaaaaccgagacgagtggtgatccgaacgcggcgcgatgctccaactgccgaaccgacaagacaaccgcgtggcgacgtgacgccgaggggaagcttgtctgcaatccgtgtgggctctactatcgattgcacaaggttcgccgaccaatagaaatgcgcaaaaaccacatccaacaacgctaccgccgaaagaacaaggaaaaagagtcgtcggcggcaacacagatcttcaaccaactcctcacacaaatgccgacgatggcgaccggcggagtgagcactgatggagccatcaacacattcaatttactcgagcaaatctcgcaattc | |||
| Experiment | Laboratory | JR | |||
| Date | 16 May 2001 00:00:00 | ||||
| Treatment | To characterize the epidermis in elt-5(RNAi) embryos, authors visualized their epithelial adherens junctions with monoclonal antibody MH27. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F55A8.1a | Inferred_automatically | RNAi_primary | |
| F55A8.1b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001186 | Inferred_automatically | RNAi_primary | ||
| Transcript | F55A8.1b.1 | Inferred_automatically | RNAi_primary | ||
| F55A8.1a.2 | Inferred_automatically | RNAi_primary | |||
| F55A8.1a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004833 | ||||
| Phenotype | WBPhenotype:0000166 | Remark | In an elt-5(RNAi) embryo at the ~2.5- fold stage, one of the seam cells, V1, does not show adherens junctions, indicating that it has fused with the neighboring hyp7 syncytium on the dorsal and ventral sides. In addition, in an embryo slightly past the comma stage V1 is ventrally misplaced, and its neighbors, H2 and V2, inappropriately contact each other. | ||
| Method | RNAi |
