WormBase Tree Display for RNAi: WBRNAi00077982
expand all nodes | collapse all nodes | view schema
| WBRNAi00077982 | Homol | Homol_homol | CHROMOSOME_IV:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gacgagctgctcaaagagaacaatgagctgaaaagctcatcggtctcatcgggaaaagcctcaccatcaccggcagagtcgaggagctctccgaagcttgtcgagacagtagtcgctccagtatcaggagcccggaagcggaagcccaaggagcggagcccaccggcagctgcgagtccacttccagacttttcgaatttgatgaacggattcatgtttgatcctctgaatatgtcaaatccaaatggaatgatgcaattattatcaatggttcaacagcagcagcagcagcaacaacaccaccagcacattgagaatcaacaatccgtgagcccaccacaatcgaaatccgtgaaaattgaagatccaatggatcaggatgtgaaacaggaagagtcggagcgatccgatatcccgacggctacagaggcgcagaaccttttggatgcactaacagcacagtttagcagcaacggacaggcgacctccaccacatctccaccatcatcatcatcccaagtacaagcggtcatcgaagcagtcgccacaccatcatcccaaagccaagacagttcaatgtttgagaaaaccgagacgagtggtgatccgaacgcggcgcgatgctccaactgccgaaccgacaagacaaccgcgtggcgacgtgacgccgaggggaagcttgtctgcaatccgtgtgggctctactatcgattgcacaaggttcgccgaccaatagaaatgcgcaaaaaccacatccaacaacgctaccgccgaaagaacaaggaaaaagagtcgtcggcggcaacacagatcttcaaccaactcctcacacaaatgccgacgatggcgaccggcggagtgagcactgatggagccatcaacacattcaatttactcgagcaaatctcgcaattc | |||
| Experiment | Laboratory | JR | |||
| Date | 16 May 2001 00:00:00 | ||||
| Treatment | To investigate a possible post-embryonic role for elt-5 , authors injected hermaphrodites with lower levels of elt-5 dsRNA. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F55A8.1a | Inferred_automatically | RNAi_primary | |
| F55A8.1b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001186 | Inferred_automatically | RNAi_primary | ||
| Transcript | F55A8.1b.1 | Inferred_automatically | RNAi_primary | ||
| F55A8.1a.2 | Inferred_automatically | RNAi_primary | |||
| F55A8.1a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004833 | ||||
| Phenotype | WBPhenotype:0000032 | ||||
| WBPhenotype:0000059 | Remark | arrested at various stages of larval development | |||
| WBPhenotype:0000638 | |||||
| WBPhenotype:0000645 | Remark | weak | |||
| Penetrance | Low | ||||
| WBPhenotype:0000646 | |||||
| WBPhenotype:0000697 | Remark | weak | |||
| Penetrance | Low | ||||
| Method | RNAi |
