WormBase Tree Display for RNAi: WBRNAi00077440
expand all nodes | collapse all nodes | view schema
WBRNAi00077440 | Homol | Homol_homol | F23B12:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atgctgatgctcacctttgcctcaacctcttcggatcttctaccaatgtccaacgtttttgacgttcaatcttccgttttctacaacgaaaagaacatgttctactcctcgtctcaggacttctcctcgtgtgaagattcttctcaatttgccgacgactcgggattttttgatgactctgagatcagcagcatcggctacgagatcggctccaagctagcagcaatgtgcgatgacttcgatgctcagatgatgtcctactcggcccatgcttccgacagaagcctcttccatcgtcttctggactttttcgctttttaa | |||
Experiment | Laboratory | CM | |||
Date | 06 Sep 2006 00:00:00 | ||||
Genotype | pax-2(ok935) egl-38(n578) | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | F23B12.9 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00001170 | Inferred_automatically | RNAi_primary | ||
Transcript | F23B12.9.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000009197 | ||||
Reference | WBPaper00028561 | ||||
Phenotype | WBPhenotype:0000182 | Remark | egl-1RNAi decreased the number of cell corpses in the pax-2(ok935) egl-38(n578) mutant background, egl-1 is epistatic to pax-2(ok935) egl-38(n578). Counted average number of visible cell corpses in comma to 1.5-fold stage embryos. | ||
Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. Primer sequences available by request from authors. | ||||
Method | RNAi |