WormBase Tree Display for RNAi: WBRNAi00075713
expand all nodes | collapse all nodes | view schema
WBRNAi00075713 | Homol | Homol_homol | Y71F9B:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gaccagcaattgagccaacacaattggtatacacacgggaaaacgatgaagaatttcaaggatctttactatcaagttttggagaagtcgatgattattatgtaaaaacctcaacaatcggaagaactcgaccacagcctcgcccgaagcgtgagccgaatcagctgacaagtatggatatgatgtctgcagaacttgacaaaagccgtcacaccatggaaggatcaatgcgtgatgctcaaacatcaagcttcctcgacgcggcccgtgtccgaatgaaacaatccattggtgcagctcacgctgttggacttgcaagccatcagccaccagcttctccagtcgcagcagcagcagcagctccaggcggtccgatgaggcataattcatatccgagtggctttgaaccgccgccgtcggtggctccgtatgatttccctgctgatccatcaaagaagcagcggaaacagcgtgccaagaagcagcctggagaagagccgccggctggaaggggtaaaggagggaagaagggacgaggagctggagcagttggagcagcagcggctggtggaaggaaaagtgctggtggagctggagaaaatccgtttgggatggatccgatgaggcctccgatgttgcagaggagctcgagtgaacagc | |||
Experiment | Laboratory | EM | |||
Date | 15 Dec 2000 00:00:00 | ||||
Genotype | egl-5(n945); him-5(e1490) | ||||
Temperature | 20 | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | Y71F9B.10c | Inferred_automatically | RNAi_primary | |
Y71F9B.10b | Inferred_automatically | RNAi_primary | |||
Y71F9B.10d | Inferred_automatically | RNAi_primary | |||
Y71F9B.10g | Inferred_automatically | RNAi_primary | |||
Y71F9B.10e | Inferred_automatically | RNAi_primary | |||
Y71F9B.10a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004946 | Inferred_automatically | RNAi_primary | ||
Transcript | Y71F9B.10g.1 | Inferred_automatically | RNAi_primary | ||
Y71F9B.10d.1 | Inferred_automatically | RNAi_primary | |||
Y71F9B.10c.1 | Inferred_automatically | RNAi_primary | |||
Y71F9B.10e.1 | Inferred_automatically | RNAi_primary | |||
Y71F9B.10b.1 | Inferred_automatically | RNAi_primary | |||
Y71F9B.10a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction | WBInteraction000008559 | ||||
Reference | WBPaper00004616 | ||||
Phenotype_not_observed | WBPhenotype:0002210 | Remark | no extra rays are formed in sop-3(RNAi), egl-5 mutants indicating that egl-5 activity is required for the duplicated V6-rays in sop-3(RNAi) males | ||
Method | RNAi |