WormBase Tree Display for RNAi: WBRNAi00075707
expand all nodes | collapse all nodes | view schema
| WBRNAi00075707 | Homol | Homol_homol | AH6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gatgccacaaatccagtcgactaatcctcaacagtctgaacaactgagaaaatcgggtgctcaaataagcaccacgcgtacagttccgttgacttcgtcgact | |||
| Experiment | Laboratory | JJ | |||
| Date | 07 Dec 2000 00:00:00 | ||||
| Genotype | efl-1(se1ts) | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene | AH6.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003231 | Inferred_automatically | RNAi_primary | ||
| Transcript | AH6.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000008555 | ||||
| Reference | WBPaper00004634 | ||||
| Phenotype | WBPhenotype:0000715 | Remark | Removing mex-6 activity does not appear to exacerbate or suppress the Mex phenotype of this mutant | ||
| Method | RNAi |
