WormBase Tree Display for RNAi: WBRNAi00075651
expand all nodes | collapse all nodes | view schema
| WBRNAi00075651 | Homol | Homol_homol | C35C5:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | cctacccacagacggatgttttcattctctgcttctctgtcgtctcgcccgtatcgtttgacaatgtggcaagcaagtggattccggaaatacgacagcattgtccagatgcgcctgtcattctagttggtaccaaactcgatttgcgcgacgaggccgaaccgatgcgtgctctgcaggccgaaggaaagtccccaatttccaaaacgcaaggcatgaaaatggctcaaaaaattaaagctgtcaagtatttggaatgctctgcattgac | ||||
| Experiment | Laboratory | JE | ||||
| Date | 21 May 2007 00:00:00 | |||||
| Strain | WBStrain00004472 | |||||
| Delivered_by | Bacterial_feeding | |||||
| Inhibits | Predicted_gene | C35C5.4b | Inferred_automatically | RNAi_primary | ||
| C35C5.4a | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00003239 | Inferred_automatically | RNAi_primary | |||
| Transcript | C35C5.4b.1 | Inferred_automatically | RNAi_primary | |||
| C35C5.4a.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Interaction | WBInteraction000008526 | |||||
| Reference | WBPaper00030828 | |||||
| Phenotype | WBPhenotype:0000195 | Remark | RNAi treatment did not reduce the extent of distal tip cell (DTC) migration in vab-3(e1796)animals. In vab-3(e1796) the DTC does not stop migration, authors call this perpetual DTC migration. | |||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
| Method | RNAi |
