WormBase Tree Display for RNAi: WBRNAi00075437
expand all nodes | collapse all nodes | view schema
| WBRNAi00075437 | Homol | Homol_homol | ZC13:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atattcgttgtgtgatcgcgacttctgtttgagggctgtcaacatatacacgttcattgcatattcctcccactgacgctgttttcttttcatccgaatatctggattcctttcccgccaaaaccaatgacaattactcgtattctcacatgcctacttatttgtttatttattcggataccggcagcgggtacgaaaacaacacaattaatattcaagagattcacagaagagacatgtcagaatgatccgtgtttgaatggagggacttgtacacctggaaaactgtcatgtacatgtgcaactggatggatgggaagatattgtcacagaaagtgtcgtaacatctacaagagttgcgatcgatgggccgtggaagacaaatgccacacaattctcactcaaaccaacttctttgacgtcaactgtgctatatcctgcaaaatgtgctctcctgacccaaactacgtagcccctgaaattccacttgcaccagc | |||
| Experiment | Laboratory | KC | |||
| Date | 18 Nov 2007 00:00:00 | ||||
| Genotype | rrf-3(pk1426); him-5(e1490) | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | ZC13.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003104 | Inferred_automatically | RNAi_primary | ||
| Transcript | ZC13.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031131 | ||||
| Phenotype | WBPhenotype:0000070 | Remark | authors state greater than 5 percent of the animals show the typical Mab-7 phenotype (swollen sensory rays) | ||
| WBPhenotype:0000505 | Remark | authors state greater than 5 percent of the animals show the typical Mab-7 phenotype (swollen sensory rays) | |||
| Method | RNAi |
