WormBase Tree Display for RNAi: WBRNAi00066318
expand all nodes | collapse all nodes | view schema
| WBRNAi00066318 | Homol | Homol_homol | CHROMOSOME_I:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgcaagcgtggaactgtcgtgaggtatggcgccgcatacgcaaacaccttgcacacacatcgagaactaccgtatactcgcagtttaaatttcaaattttcgaaatttttttccaatcatttttccctatttttcttcatttcgctgctaaaaatagttgttttgaacccgattttctcgattcgccgctaccatctgacatcacactgcacaatctcgaaccggcaaggcctgattccggaatgagtttttccactgattttgacgatgatttcttcaatctcgacctccatcaacaagagcgttcggcttcttttggcggagtaacccagtattctcaacaatttcttcgcgaaaaatgctcgttctctccgtatttccacacatctttagagactgttgacagcggaagaactagcctatacgggagcaatgagcaatgtggacagctcggcggagcatcttcaaacgggtcgacagcaatgcttcatactccagatggaagcaattctcatcagacatcgtttccttcggatttcagaatgtccgaatcgccagacgataccgtatcgggaaaaaagacaacgaccagacggaacgcttggggaaatatgtcatatgctgaacttatcactacagccattatggctagtccagagaaacggttaactcttgcacaagtttacgaatggatggtccagaatgttccatacttcagggataagggagattcgaacagttcagctggatggaagaactcgatccgtcacaatctgtctcttcattctcgtttcatgcgaattcagaatgaaggagccggaaagagctcgtggtgggttattaatccagatgcaaagccaggaaggaatccacggcgtacacgtgaacgatccaatactattgagacgactacaaaggctcaactcgaaaaatctcgccgcggagccaagaagaggataaaggagagagcattgatgggctcccttcactcgacacttaatggaaattcgattgccggatcgattcaaacgatttctcacgatttgtatgatgatgattcaatgcaaggagcatttgataacgttccatcatctttccgtccccgaactcaatcgaacctctcgattcctggatcgtcgtctcgtgtttctccagctattggaagtga | |||
| Experiment | Laboratory | CF | |||
| Date | 22 Aug 2002 00:00:00 | ||||
| Genotype | daf-2(e1370) | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene (11) | ||||
| Gene | WBGene00000912 | Inferred_automatically | RNAi_primary | ||
| Transcript (11) | |||||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005488 | ||||
| Phenotype_not_observed | WBPhenotype:0000039 | Remark | daf-16 RNAi suppressed the delayed development, extended lifespan and late onset of the reproductive period (protracted reproduction) observed in daf-2(e1370) mutant animals. The suppression of life span extension was observed when animals were switched onto RNAi at different ages, even as adults. In contrast, the suppression of protracted reproduction only observed if RNAi treatment is initiated before L4. | ||
| WBPhenotype:0000613 | Remark | daf-16 RNAi suppressed the delayed development, extended lifespan and late onset of the reproductive period (protracted reproduction) observed in daf-2(e1370) mutant animals. The suppression of life span extension was observed when animals were switched onto RNAi at different ages, even as adults. In contrast, the suppression of protracted reproduction only observed if RNAi treatment is initiated before L4. | |||
| WBPhenotype:0000848 | Remark | daf-16 RNAi suppressed the delayed development, extended lifespan and late onset of the reproductive period (protracted reproduction) observed in daf-2(e1370) mutant animals. The suppression of life span extension was observed when animals were switched onto RNAi at different ages, even as adults. In contrast, the suppression of protracted reproduction only observed if RNAi treatment is initiated before L4. | |||
| Method | RNAi |
