WormBase Tree Display for RNAi: WBRNAi00063702
expand all nodes | collapse all nodes | view schema
| WBRNAi00063702 | Homol | Homol_homol | C06G3:RNAi | ||
|---|---|---|---|---|---|
| C33H5:RNAi | |||||
| Sequence_info | DNA_text | gttcggacggaattcgcatcacagttggacgaagccgaagttgaacaacttcgactgaagacagaaaacaactccttgagattggaaaacgtcgatcttcgtgcaaagtatgactttgctcttctgaagtacacgatcggatcagaaaacgaacagattgttaacgagttcaagaagatcatcagtgaattcag | |||
| Experiment | Laboratory | OLB | |||
| Date | 14 Jul 2003 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Inhibits | Predicted_gene | C06G3.2 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002228 | Inferred_automatically | RNAi_primary | ||
| Transcript | C06G3.2.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006197 | ||||
| Phenotype | WBPhenotype:0001151 | Remark | defects in formation of female pronucleus | ||
| Remark | recorded the consequences of KLP-18 depletion in live klp-18(RNAi) embryos by using Nomarski video differential interference contrast microscopy | ||||
| Method | RNAi |
