WormBase Tree Display for RNAi: WBRNAi00063277
expand all nodes | collapse all nodes | view schema
| WBRNAi00063277 | Homol | Homol_homol | T03F1:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cgtcgcccacttcttgcattctgtctttgttgcttcttttcctgcgccaaagcccttttgttggccttatctttcagctctcgctcggttgctgttctgacgtcagcagttctgtaatagcacaaacgcggatccttgatgacaacggccgtcacaccagtcaatcgcttgcagccactaatcggcgaattgacataaaccggttgttctccaagccacgaacgaacaggcttcacgcggacacgcgtcgatcttcggacaccgtctggagcatcttctggcttc | |||
| Experiment | Laboratory | AR | |||
| Date | 23 Apr 2001 00:00:00 | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene | T03F1.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001832 | Inferred_automatically | RNAi_primary | ||
| Transcript | T03F1.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004735 | ||||
| Phenotype | WBPhenotype:0001102 | Remark | chromosomes failed to orient perpendicularly to the mitotic spindle and the kinetochore fiber was absent | ||
| WBPhenotype:0001910 | Remark | Chromosomes failed to orient perpendicularly to the mitotic spindle and the kinetochore fiber was absent. | |||
| Remark | stained early embryos with antibodies directed against tubulin | ||||
| Method | RNAi |
