WormBase Tree Display for RNAi: WBRNAi00061281
expand all nodes | collapse all nodes | view schema
| WBRNAi00061281 | Homol | Homol_homol | C47G2:RNAi | ||
|---|---|---|---|---|---|
| F22B5:RNAi | |||||
| Sequence_info | DNA_text | ctcaccactgccttccagacccaggtcgtaccaatgccagtctgcaaatacgagatccttgacggaggaccatccggacaaccaatccagttcgccaccatcggacaacaagtctatcacaaatggacttgcgattctgagaccactgacaccttctgcgccgtcgttcactcttgcactgtcgatgatggtaatggcgacaccgttcagattcttaacgaagaaggatgtgctcttgacaagttcttgctcaataacttggagtacccaactgacttgatggctggccaagaagctcacgtctacaaatatgccgatcgctcccaactcttctatcaatgccaaatctccatcaccatcaaggacccaggaagcgaatgtgcccgtccaacttgctcagagccacaaggattcggagccgtcaaacaagctggtgccggaggagctcatgccgccgctgctccacaagctggagttgaagaagttcaagctgctccagtcgccgctgccgctccagttgctgctccagtggcagctgctgcagcagctccagccgttccacgtgccacacttgctcagttga | |||
| Experiment | Laboratory | NA | |||
| Date | 15 Mar 2005 00:00:00 | ||||
| Genotype | daf-7(e1372) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C47G2.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000851 | Inferred_automatically | RNAi_primary | ||
| Transcript | C47G2.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00025242 | ||||
| Phenotype | WBPhenotype:0000583 | Remark | dauer larvae | ||
| WBPhenotype:0001228 | Remark | dauer larvae lack alae | |||
| WBPhenotype:0001545 | Remark | dauer larvae lack alae | |||
| WBPhenotype:0001551 | Remark | Wider lateral cuticle in dauer larvae. | |||
| WBPhenotype:0001552 | Remark | The pharynx was bent to fit the reduced length of the animal in dauer. | |||
| Remark | If grown at 25 degrees celsius, 100% of the larvae carrying daf-7(e1372) will develop into dauer larvae | ||||
| Method | RNAi |
