WormBase Tree Display for RNAi: WBRNAi00061131
expand all nodes | collapse all nodes | view schema
| WBRNAi00061131 | Homol | Homol_homol | R07G3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgcagacgatcaagtgcgtcgtcgttggagatggagctgtcggtaaaacttgtctcctgatcagctataccacaaacaagtttccttctgagtatgtgccgacagtcttcgacaattacgccgtcacagtaatgatcggtggcgagccatacacattaggattgtttgatactgctggacaggaagattacgatcgattaaggcctctatcgtatccacagaccgacgtgtttcttgtttgcttctccgtggttgctccagcttcattcgagaatgtccgagaaaaatgggtgcctgaaatttcgcatcattgctcaaagaccccattcttgttagttggtactcaagtcgatctcagggatgatccaggaatgctcgagaaactggcaaaaaacaagcagaaaccagtgtcaacggatgttggagagaagttggcaaaggaattgaaagcagtgaaatacgttgaatgctcagcgttgacgcagaagggactgaaaaatgtattcgacgaagccattctggccgctctcgacccaccacaacaggagaagaagaagaagtgcaatattctctag | |||
| Experiment | Laboratory | NR | |||
| Date | 25 Jul 2005 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | R07G3.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000390 | Inferred_automatically | RNAi_primary | ||
| Transcript | R07G3.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00026657 | ||||
| Phenotype | WBPhenotype:0000643 | ||||
| WBPhenotype:0000926 | Remark | Inhibited the organization of consecutive actin filaments in body-wall muscles. | |||
| WBPhenotype:0001587 | Remark | Inhibited the organization of consecutive actin filaments in body-wall muscles. | |||
| Remark | L1-feeding RNAi - Eggs were laid onto the feeding plates for 12 h, and RNAi phenotypes were checked at 72 h after hatching | ||||
| Method | RNAi |
