WormBase Tree Display for RNAi: WBRNAi00007474
expand all nodes | collapse all nodes | view schema
| WBRNAi00007474 | History_name | SA:yk380e3 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | C34F11:RNAi | |||
| Sequence_info | DNA_text | ccaccaggagacatccagacccagccgggtacgaagatcgtgtttaatgcaccatacgatgacaagcacacttatcacattaaagtgatcaactcatctgctcgccgtattggatacggtatcaagaccaccaacatgaagagacttggagttgatccaccatgtggagtactcgacccaaaggaagctgttcttctggctgtttcctgtgatgcctttgcattcggacaggaggacactaacaatgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgtcgggaatggttccaaggagatggtatggtccgccgtaagaacctccccatcgagt | yk380e3 | ||
| Sequence | yk380e3 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | C34F11.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003443 | Inferred_automatically | RNAi_primary | ||
| Transcript | C34F11.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype | WBPhenotype:0000032 | ||||
| WBPhenotype:0000689 | |||||
| Remark | yk380e3 | ||||
| msp-49 | |||||
| (24hr-) P0 sterile,unhealthy | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
