WormBase Tree Display for RNAi: WBRNAi00005010
expand all nodes | collapse all nodes | view schema
| WBRNAi00005010 | History_name | [cgc4742]:nhr-23 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | C01H6:RNAi | |||
| Sequence_info | DNA_text | gttatcagagctttcaatcagcagcacagttcctatacaacacaacatggagtttgtaacgtggatcctgattgtattcctcatttgagtcgagctggtggttgggagctcttcgctagggagctcaatccgcttattcaagcaattattgagtttgccaaaagtattgatggatttatgaatcttccgcaagaaacacagattcaattgctgaagggaagcgtttttgagttatcactcgtttttgctgctatgtattacaatgtagacgcgcaggcagtgtgcggtgaaaggtattctgttccatttgcatgcttgattgccgaagatgatgccgaggtatttattttcatagagtaatatcggctcatactcaatgtttcagatgcaattgatcgttgaagttaataacactcttcaagaaattgttcatttacaaccgcatcaatccgaattagctcttcttgccgctggacttattctggagcaagtgtcttcttctcatggaattgggattcttgacactgcgacgattgccactgcagaaacactgaagaacgcgttgtaccaaagtgtcatgccaagaatt | [cgc4742]:nhr-23 | ||
| Sequence | [cgc4742]:nhr-23 | ||||
| Experiment | Date | 19 Jun 2001 00:00:00 | |||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C01H6.5b | Inferred_automatically | RNAi_primary | |
| C01H6.5f | Inferred_automatically | RNAi_primary | |||
| C01H6.5d | Inferred_automatically | RNAi_primary | |||
| C01H6.5a | Inferred_automatically | RNAi_primary | |||
| C01H6.5c | Inferred_automatically | RNAi_primary | |||
| C01H6.5e | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003622 | Inferred_automatically | RNAi_primary | ||
| Transcript | C01H6.5d.1 | Inferred_automatically | RNAi_primary | ||
| C01H6.5a.1 | Inferred_automatically | RNAi_primary | |||
| C01H6.5c.1 | Inferred_automatically | RNAi_primary | |||
| C01H6.5b.1 | Inferred_automatically | RNAi_primary | |||
| C01H6.5f.1 | Inferred_automatically | RNAi_primary | |||
| C01H6.5e.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004742 | ||||
| Phenotype | WBPhenotype:0000054 | ||||
| WBPhenotype:0000059 | Remark | developmental arrest and lethality for larvae and adults | |||
| Penetrance | Range | 99 | |||
| WBPhenotype:0000535 | Remark | defective male tail | |||
| distal-tip cell mispositioned | |||||
| misshapen gonad | |||||
| WBPhenotype:0000638 | Remark | defects in all 4 larval molts | |||
| Remark | RNAi by Soaking produced similar defects | ||||
| reduced dpy-7 RNA expression | |||||
| Method | RNAi |
