WormBase Tree Display for RNAi: WBRNAi00005000
expand all nodes | collapse all nodes | view schema
| WBRNAi00005000 | History_name | [cgc4735]:hcp-4 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | T03F1:RNAi | |||
| Sequence_info | DNA_text | cgtcgcccacttcttgcattctgtctttgttgcttcttttcctgcgccaaagcccttttgttggccttatctttcagctctcgctcggttgctgttctgacgtcagcagttctgtaatagcacaaacgcggatccttgatgacaacggccgtcacaccagtcaatcgcttgcagccactaatcggcgaattgacataaaccggttgttctccaagccacgaacgaacaggcttcacgcggacacgcgtcgatcttcggacaccgtctggagcatcttctggcttc | [cgc4735]:hcp-4 | ||
| Sequence | [cgc4735]:hcp-4 | ||||
| Experiment | Laboratory | AR | |||
| Date | 11 Jun 2001 00:00:00 | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene | T03F1.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001832 | Inferred_automatically | RNAi_primary | ||
| Transcript | T03F1.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004735 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | chromosomes fail to segregate at anaphase | ||
| defective association of HCP-1 to centromere | |||||
| defective chromosome attachments to the spindle | |||||
| possible defects in sister centromere resolution | |||||
| Method | RNAi |
