WormBase Tree Display for RNAi: WBRNAi00001728
expand all nodes | collapse all nodes | view schema
WBRNAi00001728 | History_name | SA:yk343c9 | |||
---|---|---|---|---|---|
Homol | Homol_homol | B0035:RNAi | |||
Sequence_info | DNA_text | ccaataggtcatggaccacctggtggcccacccatgcctggtcctcctcaaagaagccgatttgatcaacctgacggcggagacaggtggggtccaccaatgcgaggagtaccacggacgccaccatatgaaaacgagcatggtgagtttatggcattcgtaaaagcttgatttagcaagctaataaatttcagaacatcaagattatcaagctccagatgactacaatcaaggaggatacgatgatcggtttagagaaggtgatcgtggaggtccaccgggaggtagccgatttgatcaagtgaaagctgaactaaaggaggaaatcgtcgaggtatattccttgatttc | yk343c9 | ||
Sequence | yk343c9 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | B0035.1a | Inferred_automatically | RNAi_primary | |
B0035.1b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00007105 | Inferred_automatically | RNAi_primary | ||
Transcript | B0035.1a.1 | Inferred_automatically | RNAi_primary | ||
B0035.1b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed | WBPhenotype:0000050 | ||||
WBPhenotype:0000062 | |||||
WBPhenotype:0000535 | |||||
WBPhenotype:0000689 | |||||
WBPhenotype:0000886 | |||||
Remark | yk343c9 | ||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |