WormBase Tree Display for RNAi: WBRNAi00000841
expand all nodes | collapse all nodes | view schema
| WBRNAi00000841 | History_name | SA:yk252e6 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | Y48A6A:RNAi | |||
| Sequence_info | DNA_text | ttggaaaagataaatgaataaatgggaaggggaatatgcttttaaaaaacggagaaaaatgaccatttttgcagacaataatttattatttgaagctgttttcaggccatcatgtagatgactgaagcgtcctgatgcacggatccaagtggatttgaagcgacgcatcggaacgattccgagattgtttcctcgtcaccaactattagtagatcaccgtttgaaaggtgctgaaaaataaaattaaatgttggatagtaaagtagaaatttttacgcgcaattttatttcttccttcattatggcgtgttttagcagtttatcgatttttttggttaaacacttttaaaaaattgtgttgctcgtaagatttttaaaaataatattatatgtctccttacgttttgaaagctctgcgaccagcgatacaatgcacaacattttttttttcaaaatttgaaactatcgatattggaaaaatcgataaactactcaaatttaacgaccaactctataataatcactcaccatataattgggttgtccatcaattgtgctcaacgactcgtcctcctcaatcttgaaccatttcgtttttggcgttggaactccgcgaacacggcacgccaattgagcaacaccgcccggtaactcgattcgtgaaagtgtgaaatcggagacgatgggcggcgattcgagtggttgccgaatcgatttgcatgttcccgttatcgattttggcgctgaaattttggaaaactgtaagttagggctttcgggcggcgccgctcctcattccattctgctgcga | yk252e6 | ||
| Sequence | yk252e6 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | Y48A6A.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006982 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y48A6A.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | %penetrance | ||
| Penetrance | Range | 5 | |||
| Remark | yk252e6 | ||||
| zig-5 | |||||
| (24hr)- embryonic lethal (5%) | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
