WormBase Tree Display for RNAi: WBRNAi00000839
expand all nodes | collapse all nodes | view schema
WBRNAi00000839 | History_name | SA:yk252d2 | |||
---|---|---|---|---|---|
Homol | Homol_homol | C32F10:RNAi | |||
Sequence_info | DNA_text | tccttcttttttggttcaatattctcttcatctggatcagattctccagttcctgaagcatctttctctgagccagaatcatattcatcgtcaggttcacttccagaaccttctgatgagtctttgtcattcttctgcttcttcatatccttatccaaatcataatcctcatcagtactttcatcatcgctgtcatcatcttgttcacgaccctctgctttcacagttgacttgtatggatcgatatcatcttcatcgctgcttccataaccagctgatttgttatcgatacgatgagaattgcgaattttgatctctttcttgtttagatagtcgaat | yk252d2 | ||
Sequence | yk252d2 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | C32F10.5 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00001973 | Inferred_automatically | RNAi_primary | ||
Transcript | C32F10.5.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0001037 | Remark | %penetrance | ||
Penetrance | Range | 100 | |||
Remark | yk252d2 | ||||
F1 sterile (100%) | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |