WormBase Tree Display for RNAi: WBRNAi00000485
expand all nodes | collapse all nodes | view schema
WBRNAi00000485 | History_name | SA:yk205f3 | |||
---|---|---|---|---|---|
Homol | Homol_homol | K10B3:RNAi | |||
Sequence_info | DNA_text | agcattgaaatgctcctcctcttggaactgttgagcaagttgcttgattccatcaacacgatcgttgtgagcgttaaaatcagactcaataagtccaatcttcttctgaaggttttgaacagatacaagatcttttccataatcctcggaagcaacttgtccttcaagctccgacaaccatgcttcaacatcttcaatgttgcgattgaattgctgttcgtttccagcttcacgaagtttggctcccttcttgtttgtagcatcgaccaattcgttccacaagttgttgacttgacgaaggcggtctccgatctgaaaaaaagttactaatagttataaaaagttgataacttacatgatcagcagcaaagtgtccactatcgatgatttgctctccggtagaacgaatatcgtccaaacggttctcgttagccttaagctcttgctcaaagttgatgtgcttttggagttttccacgaatgttggtaggatccaagtaagaatcgtcacgagcggtggacagtttttcagtgatccagctaaccatctcatcacagtcacggtcaaatgtctggcgcttgtagctttccttgagagcatttccacgttgacgagctctgtctagaag | yk205f3 | ||
Sequence | yk205f3 | ||||
Experiment | Laboratory | SA | |||
YK | |||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | K10B3.10a | Inferred_automatically | RNAi_primary | |
K10B3.10b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00004951 | Inferred_automatically | RNAi_primary | ||
Transcript | K10B3.10a.1 | Inferred_automatically | RNAi_primary | ||
K10B3.10b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype | WBPhenotype:0000059 | ||||
WBPhenotype:0000535 | |||||
Remark | yk205f3 | ||||
spc-1 | |||||
L1 arrest,round head | |||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |