WormBase Tree Display for RNAi: WBRNAi00000322
expand all nodes | collapse all nodes | view schema
| WBRNAi00000322 | History_name | SA:yk175f7 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | C14B9:RNAi | |||
| Sequence_info | DNA_text | aacaagatacacgaaaaaaccattggttgttgtatattataatgctgatttctccgttcaatatagagaaggaagtgaatactggagatccaaagttttgaatattgctcagaaatatcaaaaggacaagtacaagttcgctgttgctgatgaagaggagtttgccaaagaacttgaagagcttggacttggagattctggacttgagcataatgtagttgtatttggttatgatgga | yk175f7 | ||
| Sequence | yk175f7 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | C14B9.2 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00015752 | Inferred_automatically | RNAi_primary | ||
| Transcript | C14B9.2.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype | WBPhenotype:0000031 | ||||
| WBPhenotype:0000050 | Remark | %penetrance | |||
| Penetrance | Range | 36 | |||
| WBPhenotype:0001037 | |||||
| Remark | yk175f7 | ||||
| embryonic lethal (36%),escapers: slow growing,sterile adult | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
