WormBase Tree Display for Construct: WBCnstr00042038
expand all nodes | collapse all nodes | view schema
WBCnstr00042038 | Summary | [set-2p::mcherry] | |
---|---|---|---|
Driven_by_gene | WBGene00004782 | ||
Fusion_reporter | mCherry | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | [set-2p::mcherry] transcriptional fusion. The set-2 transcriptional reporter includes a 400bp region located at the 5' end of set-2 gene amplified using the following primers: 5'ccgatgcacagtagaaatctg and 5'gcaaacttcatatccagaccata. The PCR product was cloned into pD95.75mCherry. | ||
Used_for | Transgene_construct | WBTransgene00032405 | |
Reference | WBPaper00060014 |