WormBase Tree Display for Construct: WBCnstr00020808
expand all nodes | collapse all nodes | view schema
| WBCnstr00020808 | Summary | [pF55G11.2::gfp] | |
|---|---|---|---|
| Driven_by_gene | WBGene00010123 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | A genomic fragment including 1.7 Kb of F55G11.2 upstream region was amplified (annealing: 60C) using specific primers A-gaagcgcattggtctttga, and B- AGTCGACCTGCAGGCATG- CAAGCTttccagcggcggaaact, the latter tailed (capitalized), for subsequent recombinant PCR. This fragment includes part of the F55G11.3 upstream pseudogene, as well as the initial 58 bp of F55G11.2 coding sequence. Recombinant PCR fused this fragment with gfp, as previously described, using the nested primer A0 (caatttggacacggcaaact) together with the previously described D0 primer. | ||
| Used_for | Transgene_construct | WBTransgene00021193 | |
| Interactor | WBInteraction000525350 | ||
| Reference | WBPaper00046858 |
